ACTH RECEPTOR mRNA IN HUMAN ADRENOCORTICAL TUMORS: OVEREXPRESSION IN ALDOSTERONOMAS
G. Arnaldi, V. Mancini, C. Costantini, M. Giovagnetti, M. Petrelli, A. Masini, X. Bertagna* and F. Mantero
Division of Endocrinology, Dept. of Internal Medicine University of Ancona - Ancona (ITALY).
* INSERM CJF9208, ICGM, R. Descartes Univ. Paris (FRANCE) and the Comete Network
ABSTRACT
We previously reported that ACTH receptor (ACTH-R) mRNA is expressed in cortisol-secreting adrenal tumors, with significant differences between adenomas and carcinomas. In order to complete the study we have now evaluated 11 aldosteronomas (APA), 14 non-hypersecreting adenomas, 2 androgen-secreting adenomas and 8 normal adrenal glands. The level of ACTH-R mRNA was evaluated by competitive RT-PCR using a non-homologous competitor. ACTH-R gene was expressed in all tissues. All APA showed highest ACTH-R mRNA levels. Despite signs of individual heterogeneity, the level of ACTH-R transcripts was reduced in carcinomas. Furthermore, no significant differences were observed among cortisol-secreting adenomas, non hypersecreting adenomas and controls. The results show that ACTH-R mRNA is expressed in all adrenocortical tumors. The overexpression of ACTH-R in APA supports the role of ACTH on aldosterone secretion in these tumors, as also suggested by the presence of a diurnal rhythm, the lack of response to Angiotensin II, upright posture and captopril administration. The low abundance of ACTH-R in carcinomas might be a useful molecular marker of malignancy even if some overlap between carcinomas and adenomas does exist.
INTRODUCTION
ACTH is the main regulator of adrenal steroidogenesis and fetal adrenal growth. Prolonged stimulation of the adrenal gland by ACTH may result in diffuse
hyperplasia often accompanied by the occurrence of tumors as observed in congeni- tal adrenal hyperplasia (1). The ACTH receptor, a seven transmembrane G-protein coupled receptor (2), is a possible candidate oncogene for adrenal tumorigenesis. Recent studies did not find constitutively activate mutations in the ACTH-R gene in adrenal neoplasms (3, 4); nevertheless an abnormal expression of this receptor may play some role in pathogenesis and growth of adrenal tumors, as also suggested by some authors (5, 6). To further investigate this hypothesis, the level of expression of the ACTH-R gene was evaluated in various adrenocortical tumors by quantitative/competitive reverse transcriptase-polymerase chain reaction (RT-PCR).
MATERIALS AND METHODS
We studied 62 adrenocortical tumors (11 aldosteronomas (APA), 16 cortisol- secreting adenomas, 2 androgen-secreting adenomas, 14 non-hypersecreting adenomas, 19 cortisol-secreting-carcinomas) and 8 normal adrenal glands from patients who underwent nephrectomy for kidney carcinoma.
The PCR primers used for amplification of the ACTH-R were: 5’- ACTGTCCTCGTGTGGTTTTG and 5’- AAGATGAAGACCCCGAGCAG.
We constructed a non-homologous competitor using a 300 bp core sequence from pBluescript with ACTH-R primer ends, prepared by PCR. The length of the competitor differed from the normal ACTH-R transcript by 66 bp. After RNA synthesis, increasing amounts of competitor were mixed with fixed amounts of tumor RNA. The quantity of ACTH-R was determined where the ratio of synthetic/tumor ACTH-R band intensities was equal to 1. Results are presented in arbitrary units (1 U = 1 copy of ACTH-R mRNA per 0.1 µg of total RNA). Statistics were performed after logarithmic transformation of the data.
RESULTS
The expected PCR fragment of ACTH-R gene (565 bp) was readily detected in all samples. Despite evidence for individual heterogeneity, mean ACTH-R mRNA levels showed significant differences among groups (Fig.1). All APA showed the highest levels of ACTH-R mRNA. The mean ACTH-R number (4.7x106 U) was significantly higher compared to controls and other tumors (p<0.001). A low expression of ACTH-R was observed in the 2 androgen-
7,5
7
6,5
per 100 ng RNA tot (log scale)
+1 SD
6
Mean
5,5
-1 SD
5
4,5
4
3,5
×
Androgen Secreting Adenoma
Cortisol Secreting Carcinoma
Aldosterone Secreting Adenoma
Cortisol Secreting Adenoma
Non hyper secreting Adenoma
Normal Adrenal
FIGURE 1
Quantitative/competitive RT-PCR of ACTH-R mRNA. Individual results are reported as the number of copies of ACTH-R mRNA per 0.1 ug of total RNA (log scale). Statistical significance among groups is reported in the text.
secreting adenomas (1.3x10’ U). In carcinomas the mean levels of ACTH-R was 3.5x105 U; it was decreased compared to cortisol-secreting adenomas (9.5x105 U; p<0.001), non-hypersecreting adenomas (8.6x105 U; p<0.07) and controls (6.6x10 U; p<0.05). Furthermore no significant differences of ACTH-R expression were found among cortisol-secreting adenomas, non hypersecreting adenomas and controls.
DISCUSSION
The molecular mechanisms of adrenocortical tumorigenesis are still not understood (7). No activating ACTH-R mutation has been found in these tumors, suggesting that this mechanism is not important for adrenal tumorigenesis (3, 4). Furthermore, a spectrum of endocrine abnormalities can be observed when structurally normal membrane receptors are overexpressed (8). It is possible,
therefore, that altered expression of the ACTH-R plays some role in the pathogenesis of adrenocortical tumors. Recently Reincke et al. have documented, by Northern analysis of different adrenal tumors, that mean ACTH-R mRNA expression appeared to be independent of plasma ACTH concentration (5).
In the present study, we examined the expression of the ACTH-R gene in various adrenocortical tumors using a highly sensitive and specific quantitative RT- PCR technique. We confirmed that ACTH-R is well expressed in normal adrenals as well in all adrenocortical tumors with remarkable differences among groups. It is noteworthy that APA showed an overexpression of the ACTH R, almost 10 fold compared to the normal adrenal. We suggest that an enhanced transcription of ACTH-R gene could have a pathogenic role in these tumors. The ACTH-R overexpression supports the role of ACTH on the control of aldosterone secretion in APA, as suggested by the presence of diurnal rhythm, lack of response to Angiotensin II, upright posture and captopril (9). Moreover, ACTH-dependency of aldosterone secretion in APA also was confirmed by in vitro studies (10).
In accord with Reincke et al. (5), we found a low abundance of the ACTH-R in carcinomas. This finding should be related to tumor dedifferentiation and could favor enhanced clonal expansion of adrenocortical tumors. Finally, in contrast to Reincke et al. (5), we did not find any significant differences in ACTH-R expression among cortisol-secreting adenomas, non-hypersecreting adenomas and normal adrenals.
In conclusion, ACTH-R mRNA is expressed in all adrenocortical tumors and together with other types of membrane receptors, may participate in the heterogeneous phenotype of these tumors (11). ACTH-R overexpression appears specific to APA and may have a potential role in its tumorigenesis. The low abundance of ACTH-R in carcinomas may be a useful molecular marker of malignancy even if some overlap does exist. Quantitative RT-PCR of the ACTH-R could complement conventional histopathological methods in the differential diagnosis between benign and malignant adrenal tumors.
ACKNOWLEDGMENTS
This study was supported in part by AIRC and MURST ex 40%
REFERENCES
1. Jaresh S, Kornely E, Kley HK, Schlaghecke R. 1992 J Clin Endocrinol Metab 74:685-689.
Endocr Res Downloaded from informahealthcare.com by Emory University on 11/24/14 For personal use only.
2. Mountjoy KG, Robbins LS, Mortrud MT, Cone RD. 1992 Science 275:1248- 1251.
3. Latronico AC, Reincke M, Mendonca BB, Arai K, Mora P, Allolio B, Wajchenberg BL, Chrousos GP, Tsigos C. 1995 J Clin Endocrinol Metab 80:875-877
4. Light K, Jenkins PJ, Weber A, Perret C, Grossmann A, Pistorello M, Asa SL, Clayton RN, Clark AJL. 1995 Life Sci 56:1523-1527.
5. Reincke M, Beuschlein F, Latronico AC, Arlt W, Chrousos GP, Allolio B. 1997 Clin Endocrinol 46:619-626.
6. Reincke M, Mora P, Beuschlein F, Arlt W, Chrousos GP, Allolio B. 1997 J Clin Endocrinol Metab 82:3054-3058.
7. Latronico AC, Chrousos GP. 1997 J Clin Endocrinol Metab 82:1317-1324.
8. Milano CA, Allen LF, Rockman HA, Dolber PC, McMinn TR, Chien KR, Johnson RA, Bond RA, Lefkowitz RJ. 1994 Science 264:582-586.
9. Schambelan M, Burst NL, Chang BCF, Slater KL, Biglieri EG. 1976 J Clin Endocrinol Metab 43:115-131.
10. Grondal S, Grimelius L, Thoren M, Hamberger B. 1991 Eur J Surg 157:179-183.
11. Arnaldi G, Gasc JM, De Keyzer Y, Raffin-Sanson ML, Perraudin V, Kuhn JM, Raux-Demay MC, Luton JP, Clauser E, Bertagna X. 1998 J Clin Endocrinol Metab 83: 2029-2035.