ELSEVIER
SHORT COMMUNICATION
Bilateral Adrenocortical Carcinoma Showing Loss of Heterozygosity at the p53 and RB Gene Loci
Hiroshi Miyamoto, Yoshinobu Kubota, Taro Shuin, and Hiroshi Shiozaki
ABSTRACT: Presented is a rare case of nonfamilial, hormonally nonfunctional adrenocortical carci- noma with synchronous bilateral adrenal involvement. We investigated adrenal and metastatic tumors for loss of heterozygosity affecting four genetic loci containing the tumor suppressor genes p53, RB, DCC, and APC, using polymerase chain reaction and restriction fragment length polymorphism assay. Allelic losses at the p53 and RB loci were detected in all tumor samples, suggesting that the p53 and RB genes are involved in the tumorigenesis of adrenocortical carcinoma.
INTRODUCTION
Sporadic adrenocortical carcinoma is an uncommon tumor and is very rarely presented with synchronous bilateral adrenal involvement [1]. The molecular events involved in the tumorigenesis of adrenal neoplasms are incom- pletely characterized. Yano et al. [2] showed allelic losses at chromosome 17p containing p53 gene locus and at chro- mosome 13q containing RB gene locus in human adreno- cortical tumors. Recently, p53 gene mutations were also found in some adrenocortical carcinomas [3, 4].
We recently investigated a case of hormonally nonfunc- tional, bilateral adrenocortical carcinoma with metastasis. We analyzed the tumors for loss of heterozygosity (LOH) at the p53, RB, DCC, and APC tumor suppressor gene loci, using polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) analysis. The tumors of this case were found to have LOH at the p53 and RB loci.
MATERIALS AND METHODS
Patient
A 69-year-old woman presented with fever and loss of appetite. She had been in good health, and there is noth- ing in the family history to suggest malignant disease.
From the Department of Urology (H. M., Y. K., T. S.), Yoko- hama City University School of Medicine, Yokohama, Japan; and Department of Urology (H. M., H. S.), Kawasaki City Ida Hospital, Kawasaki, Japan.
Address reprint requests to: Yoshinobu Kubota, Department of Urology, Yokohama City University School of Medicine, 3-9, Fuku- ura, Kanazawa-ku, Yokohama, 236, Japan.
Received September 14, 1995; accepted October 20, 1995.
Computed tomography and magnetic resonance imaging showed tumors to arise from the right and left adrenal glands. Laboratory studies, including endocrine function tests, displayed normal values, with the exception of plasma adrenecorticotrophic hormone of 552 pg/mL (nor- mal, 30-60) and plasma aldosterone of less than 0.6 ng/dL (normal, 2-13). Exploratory surgery was performed, but complete excision of the tumors could not be attempted. The patient died of adrenal insufficiency 17 days after sur- gery. A postmortem revealed bilateral adrenal tumors (Fig. 1) which were shown to be adrenocortical carcinomas on histologic examination; each tumor weighed 160 gm. In addition, distant metastasis was found in mediastinal lymph nodes, without evidence of malignant disease else- where.
PCR-LOH Analysis
To detect LOH at the p53, RB, DCC, and APC loci, we used RFLP assays based on the PCR. Genomic DNAs were extracted from normal, right and left adrenal tumors, and metastatic tumor tissues, as described previously [5]. PCR was carried out using a DNA Thermal Cycler (Perkin Elmer Cetus, Norwalk, CT) with 50-300 ng of genomic DNA, 20 pmol of each primer, 75-mM concentrations of each deoxynucleotide triphosphate, manufacturer’s reac- tion buffer, and 2 units of Taq DNA polymerase (Perkin Elmer Cetus) in a reaction volume of 25 uL. Typical reac- tion conditions were as follows; denaturation at 94℃ for 1 minute; annealing at 55℃ for 1 minute; elongation at 72℃ for 1 minute. Annealing temperature was optimized for each primer set. Multiple primer sets were used at differ- ent loci (Table 1), described previously [6-8]. After 35 cycles of amplification, PCR products were digested with the appropriate restriction enzyme. In the cases of DCC, no
digestion was necessary for a site of variable number of tandem repeats. Each product was run on an agarose gel, which was stained with ethidium bromide and photo- graphed under UV light. LOH was defined as a visible change of one allele in the tumor DNA compared with nor- mal DNA.
RESULTS AND DISCUSSION
We analyzed DNA from a patient with bilateral adrenocor- tical carcinoma for LOH at the p53, RB, DCC, and APC loci. Allelic losses of the p53 and RB genes were seen in both adrenal tumors and metastatic lesions simultaneously (Fig. 2), while the tumors retained heterozygosity at the APC locus (data not shown). With regard to LOH of DCC, data were considered to be uninformative because normal DNA did not show two different alleles (data not shown).
To date, little is known about the genetic alterations in adrenal tumors, especially in nonfamilial, nonfunctional adrenal neoplasms. Yano et al. [2] examined six sporadic adrenocortical carcinomas for allelic losses at various loci, and showed that all patients had lost an allele on chromo- some 17p and four had lost an allele on chromosome 13q.
A (p53)
B (RB)
bp
Ma
N
L
R
M
bp
N
L
R
M
Ma
945
235
630
131
315
104
A few studies have also identified that some sporadic adrenal tumors have p53 gene mutations [3, 4]. However, to our knowledge there are few studies on alterations of the other tumor suppressor genes in adrenocortical carci- noma, except for a report [9] that LOH at the APC gene locus was found in an adrenocortical carcinoma from a patient with familial adenomatous polyposis.
Here we showed that an adrenocortical carcinoma had LOH at the p53 and RB loci, but not at the APC locus. In addition, these losses were found in all tumor samples from primary and metastatic tumors. These results con- firmed previous studies that revealed that the p53 and RB genes might be involved in the tumorigenesis of adrenal neoplasms.
Bilateral adrenocortical carcinoma are rare tumors, and these samples are very important for investigating the mech- anism for the tumorigenesis presenting with synchronous bilateral adrenal involvement, and for distant metastasis, using a molecular technique.
REFERENCES
1. Venkatesh S, Hickey RC, Sellin RV, Fernandez JF, Samaan NA (1989): Adrenal cortical carcinoma. Cancer 64:765-769.
2. Yano T, Linehan M, Anglard P, Lerman MI, Daniel LN, Stein CA, Robertson CN, LaRocca R, Zbar B (1989): Genetic changes
| Primer set | Gene | Amplicon size (base pairs) | Restriction enzyme | Primer sequencesª |
|---|---|---|---|---|
| 1 | p53 exon 4 | 235 | BstUI | GCTGTCCCCGGACGATATTG AATGCAAGAAGCCCAGACGG |
| 2 | RB intron 17 | 945 | Xbal | TTCCAATGAAGAACAAATGG GCAATTGCACAATCCAAGTT |
| 3 | DCC | 150-210 | VNTR | GATGACATTTTCCCTCTAG GTGGTTATTGCCTTGAAAAG |
| 4 | APC exon 11 | 133 | Afal | GGACTACAGGCCATTGCAGAA GGCTACATCTCCAAAAGTCAA |
Abbreviation: VNTR, variable number of tandem repeats.
“T7 promotor was attached to the 5’ end of upstream primer for single-strand conformational polymorphism analysis of RNA to de- tect p53 gene alterations [8].
Adrenocortical Carcinoma With Allelic Loss
in human adrenocortical carcinomas. J Natl Cancer Inst 81:518- 523.
3. Ohgaki H, Kleihues P, Heitz PU (1993): p53 mutations in spo- radic adrenocortical tumors, Int J Cancer 54:408-410.
4. Reincke M, Karl M, Travis WH, Mastorakos G, Allolio B, Line- han HM, Chrousos GP (1994): p53 mutations in human adrenocortical neoplasms: immunohistochemical and molec- ular studies. J Clin Endocrinol Metab 78:790-794.
5. Miyamoto H, Shuin T, Torioe S, Iwasaki Y, Kubota Y (1995): Retinoblastoma gene mutations in primary human bladder can- cer. Br J Cancer 71:831-835.
6. Boynton RF, Blount PL, Yin J, Brown VL, Huang Y, Tong Y, McDaniel T, Newkirk C, Resau JH, Raskind WH, Haggitt RC, Reid BJ, Meltzer SJ (1992): Loss of the heterozygosity involv- ing the APC and MCC genetic loci occurs in the majority of
human esophageal cancers. Proc Natl Acad Sci USA 89:3385- 3388.
7. Huang Y, Boynton RF, Blount PL, Silverstein RJ, Yin J, Tong Y, McDaniel TK, Newkirk C, Resau JH, Sridhara R, Reid BJ, Melt- zer SJ (1992): Loss of heterozygosity involves multiple tumor suppressor genes in human esophageal cancers. Cancer Res 52:6525-6530.
8. Miyamoto H, Kubota Y, Shuin T, Torigoe S, Hosaka M, Iwasaki Y, Danenberg K, Danenberg PV (1993): Analyses of p53 gene mutations in primary human bladder cancer. Oncol Res 5: 245-249.
9. Seki M, Tanaka K, Kikuchi-Yanoshita R, Konishi M, Fukunari H, Iwama T, Miyaki M (1992): Loss of normal allele of the APC gene in an adrenocortical carcinoma from a patient with familial adenomatous polyposis. Hum Genet 89:298-300.