ELSEVIER
Contents lists available at ScienceDirect
Toxicology and Applied Pharmacology
journal homepage: www.elsevier.com/locate/taap
T Tovicolor and Applied Pharmacology
The use of a unique co-culture model of fetoplacental steroidogenesis as a screening tool for endocrine disruptors: The effects of neonicotinoids on aromatase activity and hormone production
CrossMark
Elyse Caron-Beaudoin a,C,*, Rachel Viau ª, Andrée-Anne Hudon-Thibeault a,b,c, Cathy Vaillancourt a,b,c, J. Thomas Sanderson ª
ª INRS - Institut Armand-Frappier, Laval, QC H7V 1B7, Canada
b BioMed Research Center, Université du Québec à Montréal, Montreal, QC H3C 3P8, Canada
” Center for Interdisciplinary Research on Well-Being, Health, Society and Environment (CINBIOSE), Université du Québec à Montréal, Montreal, QC H3C 3P8, Canada
ARTICLE INFO
Article history: Received 12 March 2017
Revised 20 May 2017
Accepted 23 July 2017 Available online 24 July 2017
Keywords: Fetoplacental unit Steroid 16x-hydroxylase (CYP3A7) Aromatase Nonicotinoids Co-culture Estriol
ABSTRACT
Estrogen biosynthesis during pregnancy is dependent on the collaboration between the fetus producing the andro- gen precursors, and the placenta expressing the enzyme aromatase (CYP19). Disruption of estrogen production by contaminants may result in serious pregnancy outcomes. We used our recently developed in vitro co-culture model of fetoplacental steroidogenesis to screen the effects of three neonicotinoid insecticides on the catalytic ac- tivity of aromatase and the production of steroid hormones. A co-culture of H295R human adrenocortical carcino- ma cells with fetal characteristics and BeWo human choriocarcinoma cells which display characteristics of the villous cytotrophoblast was exposed for 24 h to various concentrations of three neonicotinoids: thiacloprid, thiamethoxam and imidacloprid. Aromatase catalytic activity was determined in both cell lines using the tritiated water-release assay. Hormone production was measured by ELISA. The three neonicotinoids induced aromatase activity in our fetoplacental co-culture and concordingly, estradiol and estrone production were increased. In con- trast, estriol production was strongly inhibited by the neonicotinoids. All three pesticides induced the expression of CYP3A7 in H295R cells, and this induction was reversed by co-treatment of H295R cells with exogenous estriol. CYP3A7 is normally expressed in fetal liver and is a key enzyme involved in estriol synthesis. We suggest that neonicotinoids are metabolized by CYP3A7, thus impeding the 16x-hydroxylation of fetal DHEA(-sulfate), which is normally converted to estriol by placental aromatase. We successfully used the fetoplacental co-culture as a physiologically relevant tool to highlight the potential effects of neonicotinoids on estrogen production, aromatase activity and CYP3A7 expression during pregnancy.
@ 2017 Elsevier Inc. All rights reserved.
1. Introduction
The use of in vitro models in toxicology has significantly enhanced our understanding of the mechanisms by which chemicals cause adverse effects in humans and wildlife. However, to mimic the interactions that occur in vivo is a challenge when whole animal or human studies are not possible. Well thought-out in vitro models, such as the use of co-cul- ture models, are promising approaches to study the communication be- tween different cell types in a more complex context. As example, a co- culture using primary human mammary fibroblasts and MCF-7 (epithe- lial breast cancer cells) was developed by (Heneweer et al., 2005) to
study intercellular interactions in breast cancer. More recently, we devel- oped a co-culture model that reproduces the steroidogenic fetoplacental unit and can be used to evaluate the impacts of endocrine disruptors on this delicate aspect of fetoplacental communication (Hudon Thibeault et al., 2014; Hudon Thibeault et al., 2017).
During pregnancy, the fetoplacental unit plays an important endo- crine role, ensuring, amongst others, estrogen (estrone, estradiol and estriol) biosynthesis. Estrogens are required in several physiological processes during pregnancy, such as the formation of the syncytiotrophoblast and regulation of uteroplacental blood flow (Yashwanth et al., 2006). Maternal cholesterol is converted to androgen precursors in the fetus by the action of several enzymes, such as cyto- chrome P450 17 (CYP17), sulfotransferase 2A1 (SULT2A1) and steroid 16x-hydroxylase (CYP3A7). In the placenta, CYP19 (aromatase) is re- sponsible for the final step in estrone, estradiol and estriol biosynthesis (Leeder et al., 2005; Rainey et al., 2002). Alone, the placenta cannot pro- duce estrogens de novo, as it needs the steroid precursors synthesized
* Corresponding author at: INRS-Institut Armand-Frappier, 531 boulevard des Prairies, Laval, QC H7V 1B7, Canada. E-mail addresses: elyse.caron-beaudoin@iaf.inrs.ca (E. Caron-Beaudoin),
rachel.viau@iaf.inrs.ca (R. Viau), andree-anne.hudon.thibeault@iaf.inrs.ca
(A .- A. Hudon-Thibeault), cathy.vaillancourt@iaf.inrs.ca (C. Vaillancourt), thomas.sanderson@iaf.inrs.ca (J.T. Sanderson).
by the fetus (for complete steroidogenesis pathway, see Fig. 7 in Results section). Estriol is uniquely produced during pregnancy, and its synthe- sis requires correct functioning of the fetoplacental unit (Mucci et al., 2003). Thus, a disruption in biosynthesis of estrogens such as that of es- triol may adversely alter development and influence important indica- tors of fetal health like birth weight and head circumference (Kaijser et al., 2000; Troisi et al., 2003). Moreover, decreased free estriol in ma- ternal serum has been associated with growth retardation, reduced Apgar scores and postnatal complications in a control study of 869 women (Gerhard et al., 1986).
Exposure during pregnancy to contaminants such as heavy metals, pesticides, polychlorinated biphenyls (PCBs) and phthalates have been linked to fetal growth retardation (Siddiqui et al., 2003), spontaneous abortions, learning disabilities (Hu, 1991; Abadin et al., 1997), reduced birth weight, preterm birth (Jacobson et al., 1990) and disruption of re- productive development (Mylchreest et al., 2000; Honma et al., 2002; Foster, 2006). It is not surprising that exposure to certain chemicals dur- ing pregnancy can lead to adverse pregnancy and birth outcomes, since in utero development is a critical window of vulnerability of the embryo (Bellinger, 2013). The fetoplacental co-culture model of steroidogenesis developed in our laboratory (Hudon Thibeault et al., 2014) allows us to study chemicals that may impair estrogen biosynthesis or that of other key placental hormones such as ß-human chorionic gonadotropin (B- hCG), potentially leading to serious pregnancy complications (Albrecht and Pepe, 1999; Albrecht et al., 2000; Svedas et al., 2002). We have re- ported earlier that prochloraz, a widely-used fungicide, and norfluoxetine, a selective serotonin-reuptake inhibitor, strongly inhibited aromatase activity and estrogen production in our fetoplacental co-cul- ture model (Hudon Thibeault et al., 2014; Hudon Thibeault et al., 2017).
Neonicotinoids are some of the most widely used insecticides in the world. For example, thiamethoxam and clothianidin were both in the top 10 most sold insecticides in Canada in 2010 (Health Canada, 2014). By 2012, neonicotinoids were applied to 11 million hectares in Canada, representing >216,000 kg of active neonicotinoid (Main et al., 2014). Neonicotinoids are mostly used as seed coatings on the vast majority of crops, fruits and vegetables. Moreover, their physicochemical character- istics (Kow and pKa) explain their systemic properties and their distribu- tion throughout the entire plant (Bonmatin et al., 2015; Simon-Delso et al., 2015). For this reason, neonicotinoid insecticides also target pollina- tors, mammals and humans. The scientific community is increasingly accepting that exposure to these insecticides partially explains the worldwide decline in honeybees populations (Decourtye et al., 2004; Girolami et al., 2009; Henry et al., 2012; Goulson, 2013). Neonicotinoid insecticides are also persistent in the environment. Half-lives in soil vary and can reach 1250 days for imidacloprid (Main et al., 2014). Be- cause of their persistence and repeated application, it is expected that neonicotinoids will continue to accumulate in soil (Stokstad, 2013). A re- cent study analyzed neonicotinoid levels in surface waters from 136 wet- lands across Saskatchewan, Canada. Clothianidin and thiamethoxam concentrations were detected in the majority of water samples, reaching concentrations as high as 3110 ng/L (Main et al., 2014). Moreover, human populations are also exposed to neonicotinoids through diet. A study conducted in Boston, Massachusetts, analyzed neonicotinoid resi- dues in honey, fruits and vegetables purchased in local grocery stores. Imidacloprid was the most frequently detected neonicotinoid in the samples. At least one neonicotinoid was detected in all the tested fruits and vegetables. Also, in 72% of fruits and 45% of the tested vegetables, two or more neonicotinoids were detected, with concentrations reaching 100.7 ng/g (Chen et al., 2014). Furthermore, a study conducted with a cohort of 147 farm workers from northeastern Japan evaluated the presence of neonicotinoid metabolites in urine. A metabolite of the neonicotinoid dinotefuran, 3-furoic acid, was detected in 100% of the samples at concentrations as high as 0.13 uM (Nomura et al., 2013). Moreover, the concentrations of 6-chloronicotinic acid, a metabolite of imidacloprid and thiacloprid, reached concentrations of 0.05 uM (Nomura et al., 2013).
In recent years, a growing number of studies have evaluated the en- docrine disrupting potential of neonicotinoid insecticides. We demon- strated that two neonicotinoids (thiacloprid and thiamethoxam) induce aromatase expression in a promoter-specific manner in vitro, targeting promoters known to be overexpressed in breast cancer (Caron-Beaudoin et al., 2016). Moreover, Bal et al. (2012) found that male rats exposed to imidacloprid (2 mg/kg/day) through diet showed increased apoptosis and fragmentation of seminal DNA. In female rats exposed to the same neonicotinoid (20 mg/kg/day), Kapoor et al. (2011) noted decreased ovarian weight and altered levels of follicle stim- ulating hormone and progesterone.
In this study, we used our recently developed fetoplacental co-culture model as a screening tool to determine the effects of three widely used neonicotinoid insecticides on steroidogenesis in the human fetoplacental unit, and more precisely, on aromatase activity, estrogen production and CYP3A7 expression (key enzyme in the fetal production of the estriol pre- cursor 16x-hydroxyDHEA(-sulfate). Our previous work showed that two neonicotinoid insecticides, thiacloprid and thiamethoxam, induced CYP19 expression and aromatase activity at environmentally relevant concentrations in human H295R adrenocortical carcinoma cells displaying characteristics of the fetal adrenal cortex and which repre- sents the fetal compartment of our fetoplacental co-culture (Caron- Beaudoin et al., 2016). Therefore, we hypothesized that neonicotinoids may also disrupt the production of estrogens within the fetoplacental unit.
2. Materials and methods
2.1. Chemicals
All pesticides were purchased from Sigma-Aldrich (St-Louis, MO) (thiacloprid, Pestanal 37905, purity > 99%; thiamethoxam, Pestanal 37924, purity > 99%; imidacloprid, Pestanal 37894, purity > 99%). All neonicotinoids were dissolved in dimethylsulfoxide (DMSO) as 30 or 100 mM stock solutions.
2.2. Feto-placental co-culture
The feto-placental co-culture (Hudon Thibeault et al., 2014) consists of H295R adrenocortical carcinoma and BeWo choriocarcinoma cells. H295R cells have the characteristics of the fetal adrenocortex (Gazdar et al., 1990; Staels et al., 1993) as well as that of fetal liver (Hudon Thibeault et al., 2014) and reflect the steroidogenesis that would occur in the fetal compartment. BeWo cells are a well documented model of the placental trophoblast (Ellis et al., 1990; Nampoothiri et al., 2007). This co-culture model of the fetoplacental unit is capable of de novo pro- duction of estrogens, including the unique pregnancy estrogen estriol, under our experimental conditions (Hudon Thibeault et al., 2014). Brief- ly, BeWo (ATCC no. CCL-98) and H295R (ATCC no. CRL-2128) cells were cultured separately in their respective recommended media. BeWo cells were cultured in DMEM/F-12 without phenol red (Catalog no. 11039021, Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS; Hyclone, Tempe, AZ). H295R were cultured in DMEM/F-12 (Catalog no. 11039021, Thermo Fisher Scientific, Waltham, MA), supplemented with 2.5% Nu Serum (BD Biosciences, Mississauga, ON, Canada) and 1% ITS + Premix (BD Biosciences, Mississauga, ON, Can- ada). Once confluent, BeWo and H295R cells were trypsinized, and H295R cells were seeded in 24-well plates at a concentration of 2.5 × 104 cells/well, whereas BeWo cells were seeded in transwell inserts (Corning Life Sciences, Corning, NY) at a concentration of 1.25 × 104 cells/insert, After 24 h, the co-culture was assembled by adding the in- serts containing BeWo cells to the 24-well plates containing H295R cells. The original culture media were removed and replaced with co-cul- ture media which contained DMEM/F-12 without phenol red, supple- mented with 2.5% stripped Nu Serum, 1% ITS + Premix and 1% stripped FBS, and the various concentrations of the neonicotinoids or
vehicle control (DMSO at a final concentration of 0.1%). Neonicotinoid concentrations were chosen based on our previous study that deter- mined their effects on CYP19 expression in H295R cells and an absence of cytotoxicity (Caron-Beaudoin et al., 2016). Moreover, the selected concentrations are environmentally relevant as our lower range is simi- lar to what is measured in urine samples from farm workers (Nomura et al., 2013). Exposures were for 24 h in an incubator at 37℃ with a humid- ified atmosphere containing 5% CO2.
2.3. CYP19 catalytic activity
Aromatase activity was determined as previously described (Sanderson et al., 2000; Hudon Thibeault et al., 2014; Caron-Beaudoin et al., 2016). Briefly, after the 24-h exposure period, the treated media in the insert and well were combined and removed (and stored at - 80℃ for hormone quantification), and H295R and BeWo cells were washed twice with 1 x PBS. The inserts containing BeWo cells were re- moved from the wells containing H295R cells and placed in 12-well plates for further steps. A volume of 250 uL of serum and additive-free culture medium containing 54 nM 13-3H-androstenedione (Perkin Elmer, Wellesley, MA) was added to H295R cells. This volume was 50 AL for BeWo cells. Cells were incubated for 90 min at 37℃, during which there was a linear conversion of 13-3H-androstenedione (and re- lease of tritiated water). Tritiated water was extracted from the reaction medium of each of the cell types, and counted in plates containing liquid scintillation cocktail using a Microbeta Trilux (Perkin Elmer). Formestane (1 µM), an irreversible CYP19 inhibitor, was used to ensure the specificity of the aromatase reaction. Forskolin (10 uM) was used as a positive con- trol for the induction of aromatase activity.
2.4. Hormone quantification
The following hormones, dehydroepiandrosterone (DHEA), andro- stenedione, ß-human chorionic ganodotropin (ß-HCG), estradiol, es- trone and estriol) were quantified in the co-culture media (well and insert pooled) using ELISA kits from DRG Diagnostics (Marburg, Germany).
2.5. RNA isolation and quantitative RT-PCR
RNA isolation and quantitative RT-PCR were performed as describe in Caron-Beaudoin et al. (2016). Briefly, H295R cells were cultured in CellBind 6-well plates (Corning Inc., Corning, New York) at a concentra- tion of 750,000 cells/well in 2 mL medium/well for 24 h. Cells were sub- sequently exposed for 24 h to thiacloprid, thiamethoxam or imidacloprid at 3 and 10 µM, which were the concentrations with the greatest effects on aromatase catalytic activity in the co-culture. To investigate whether the inhibitory effects of neonicotinoids on estriol production in the co- culture were responsible for altering CYP3A7 enzyme expression, H295R cells were pretreated for 4 h with estriol (5 ng/ml), prior to a 24-h exposure to thiacloprid, thiamethoxam or imidacloprid (3 µM). DMSO (0.1% or 0.2% in the case of co-treatments) was used as a vehicle control. RNA was extracted using the RNeasy mini-kit (Qiagen, Missis- sauga, Ontario) according to enclosed instructions and stored at - 80 ℃. The 260/280 nm absorbance ratio was used to verify RNA purity. Re- verse transcription was subsequently performed with 1 µg of RNA using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA) and T3000 Thermocycler (Biometra, Göttingen, Germany): cDNA was stored at - 20℃ for quantitative PCR.
Primer pair sequences and standard curves characteristics for the ref- erence genes (UBC and RPII), as well as CYP3A7 and SULT2A1, are de- scribed in Table 1. Real-time quantitative PCR was performed using EvaGreen MasterMix (BioRad) with CFX96 real-time PCR Detection Sys- tem (BioRad). Housekeeping genes were selected based on their stability for each pesticide treatment (gene expression stability (M) value below
0.5) using the geNorm algorithm method (Biogazelle qbase Plus Soft- ware, Zwijnaarde, Belgium).
2.6. Statistical analysis
Experiments were performed 3 or 4 times using different cell pas- sages, and per experiment each treatment was conducted in triplicate. Results are presented as means with standard errors. One-way analysis of variance (ANOVA) followed by a Dunnett post-hoc test, or a Student t-test was performed (JMP Software, SAS, Cary, NC), depending on the experimental design. A P-value < 0.05 was considered statistically significant.
3. Results
3.1. Effects of neonicotinoids on CYP19 catalytic activity
In this study, we determined the effects of three widely used neonicotinoids (thiacloprid, thiamethoxam and imidacloprid) on the catalytic activity of CYP19 in a co-culture of H295R and BeWo cells. Forskolin increased aromatase activity by 3.9 and 12-fold in BeWo and H295R cells, respectively (Fig. 1). Formestane (1 µM) decreased its activ- ity by 80-90% in both cell lines (not shown).
A 24-h exposure to increasing concentrations of thiacloprid induced aromatase activity in both cell types in co-culture (Fig. 1A). In BeWo cells, thiacloprid induced aromatase activity by 1.3-fold at 10 UM, which was statistically significant. In H295R cells, thiacloprid increased aromatase activity by 1.9- and 2.0-fold above control at a concentration of 0.1 and 0.3 uM, respectively. At greater concentrations this increase was no longer apparent.
A 24-h exposure of the co-culture to various concentrations of thiamethoxam induced aromatase activity in H295R cells by 1.8- and 2.2-fold above control, at 3 and 10 uM, respectively (Fig. 1B). Thiamethoxam did not affect the catalytic activity of CYP19 in the BeWo cell compartment of the co-culture (Fig. 1B). Finally, a 24-h expo- sure of the co-culture to 3 and 10 uM imidacloprid induced the aroma- tase activity in H295R cells by 2.2- and 2.4-fold, respectively (Fig. 1C), whereas in BeWo cells it was induced significantly by 2.3-fold at 10 UM only (Fig. 1C).
3.2. Effects of neonicotinoids on hormone production
Basal production of dehydroepiandrosterone (DHEA) (1962 ± 166 pg/mL), androstenedione (38.8 ± 1.4 pg/mL), estriol (486.2 ± 131.8 pg/mL), estradiol (21.9 ± 3.7 pg/mL) and estrone (363.1 ± 13.3 pg/mL) by the co-culture was similar to that found in our previous study (Hudon Thibeault et al., 2014) which initially characterized the model, although estrone and B-HCG production in our study was slightly higher than previously reported.
Thiacloprid increased DHEA production statistically significantly at 3 µM (3506 ± 450 pg/mL) and 10 µM (3912 ± 402 pg/mL), compared to vehicle control (1961 ± 166 pg/mL) (Fig. 2A), although it had no effect on androstenedione production (Fig. 2B). Thiacloprid increased ß-hCG production to a statistically significant extent at 0.1 µM (140.8 ± 24.6 mIU/mL) compared to DMSO (74.5 ± 12.3 mIU/mL), but not at greater concentrations (Fig. 2C). Thiacloprid significantly increased es- tradiol and estrone production by the co-culture at 0.1 and 0.3 µM, resulting in estradiol concentrations of 108.7 ± 32.6 and 55.4 ± 7.1 pg/mL, and estrone concentrations of 617.2 ± 48.6 and 499.7 ± 79.4 pg/mL, respectively, compared to vehicle control (estradiol: 21.9 ± 3.7 pg/mL; estrone: 363.1 ± 13.3 pg/mL) (Fig. 2D-E). Strikingly, estri- ol production in the co-culture was strongly inhibited by 0.3 and 3 uM thiacloprid (146.5 ± 76.0 and 148.8 ± 78.3 pg/mL), decreasing produc- tion to about 30% of DMSO control (486.2 ± 131.8 pg/mL) (Fig. 2F).
In the co-culture exposed to thiamethoxam, DHEA production was increased concentration-dependently and was significantly greater
| Gene | Primer pairs (5'-3') | Amplification characteristics | Reference |
|---|---|---|---|
| CYP3A7 | Fw: CTCTTTAAGAAAGCTGTGCCCC Rv: GGGTGGTGGAGATAGTCCTA | Standard curve: r2 = 0.97 Efficiency: 117.6% | Kondoh et al. (1999) |
| SULT2A1 | Fw: TCGTCATAAGGGATGAAGATGTAATAA Rv: TGCATCAGGCAGAGAATCTCA | r2: 0.982 Efficiency: 118.6% | Shiraki et al. (2011) |
| UB | Fw: ATTTGGGTCGCGGTTCTTG Rv: TGCCTTGACATTCTCGATGGT | Standard curve: 12 = 0.981 Efficiency: 109.0% | Vandesompele et al. (2002) |
| RPII | Fw: GCACCACGTCCAATGACAT Rv: GTGCGGCTGCTTCCATAA | Standard curve: r2 = 0.986 Efficiency: 100.1% | Radonić et al. (2004) |
than control (1790 ± 29.5 pg/mL) by 1.67-fold at 0.3 µM (2992 ± 166 pg/mL), by 1.9-fold at 3 µM (3464 ± 550 pg/mL) as well as at 10 UM (3436 ± 466 pg/mL) (Fig. 3A). The production of androstenedione and ß-hCG remained unchanged (Fig. 3B-C). Thiamethoxam concentra- tion-dependently increased estradiol production with a 5.0-fold increase at 10 µM (108.6 pg/mL) compared to DMSO control (21.9 ± 3.7 pg/mL) (Fig. 3D). Estrone production was increased by 2-fold (735.2 pg/mL) at 10 µM thiamethoxam compared to control production (363.1 ± 13.3 pg/mL) (Fig. 3E). Estriol production was inhibited by about 80% at all tested concentrations of thiamethoxam compared to DMSO control (Fig. 3F).
In the co-culture exposed to imidacloprid, DHEA production was sig- nificantly increased at all concentrations by about 1.7-fold (3088 ± 325 to 3381 ± 475 pg/mL) compared to control (1962 ± 166 pg/mL) (Fig. 4A), whereas androstenedione production was not affected (Fig. 4B-E). The production of ß-hCG was increased statistically significantly at an imidacloprid concentration of 10 µM (181.1 ± 19.0 mlU/mL) by about 2.8-fold above control (64.5 ± 18.9 mIU/mL) (Fig. 4C). Estradiol produc- tion was strongly elevated at 10 uM imidacloprid (158.4 ± 51.9 pg/mL) and was about 7.2-fold greater than control (Fig. 4D). Imidacloprid at all concentrations inhibited estriol production by about 80% compared to DMSO control (Fig. 4F).
3.3. Effects of neonicotinoids on mRNA levels of CYP3A7 and SULT2A
In the co-culture exposed to each of the three neonicotinoids, a signif- icant decrease in estriol production was observed. SULT2A1, expressed in the fetal adrenal, and CYP3A7, expressed in the fetal liver, are key en- zymes in the biosynthesis of the precursor for estriol, which is produced predominantly in placenta. Therefore, we wished to confirm the pres- ence of SULT2A1 and CYP3A7 in H295R cells by RT-qPCR and then deter- mine the potential effects of neonicotinoids on their expression. As a novel finding, we were able to detect SULT2A1 and CYP3A7 expression in H295R cells, confirming our previous suggestion that H295R cells act as the fetal adrenocortical as well as liver compartment of the co-culture model. SULT2A1 expression was not affected by exposure to thiacloprid, thiamethoxam or imidacloprid at 3 or 10 µM (data not shown). A 24-h exposure of H295R cells to thiacloprid at 3 and 10 µM resulted in a statis- tically significant increase in levels of CYP3A7 expression by 6.29 and 6.83-fold, respectively, compared to DMSO control (Fig. 5). Thiamethoxam at 3 µM induced CYP3A7 mRNA levels statistically signif- icantly by 5.88-fold compared to DMSO control. A 24-h exposure to 3 µM imidacloprid increased CYP3A7 expression in H295R cells by 3.75-fold compared to DMSO control, although this induction was not statistically significant (Fig. 5).
A)
Aromatase activity in co-culture (% of control)
B)
#
Aromatase activity in co-culture (% of control)
#
1500-
1000
BeWo
1500-
H295R
1000-
BeWo
500-
500-
H295R
300
300
200-
200
100-
100-
0
DMSO
Frsk 10UM
0.1 µM
0.3 µM
3 µM
10 µM
0
DMSO
Frsk 10UM
0.1 µM
0.3 µM
3 µM
10 µM
Thiacloprid
Thiamethoxam
C)
Aromatase activity in co-culture (% of control)
#
1500-
1000-
BeWo
500
H295R
500
400-
**
**
300-
200-
100-
0
DMSO
Frsk 10UM
0.3 µM
3 µM
10 µM
Imidacloprid
A)
DHEA production in co-culture (pg/mL)
B)
Androstenedione production in co-culture (pg/mL)
C)
B-HCG production in co-culture (mlU/mL)
5000
50
200
4000-
40
150-
3000
30
100
2000
20-
1000-
10
50
0
0.1 uM
0.3 uM
3 pM
10 pM
0
0
DMSO
DMSO
0.1 uM
0.3 pM
3 pM
10 pM
DMSO
0.1 µM
0,3 µM
3 UM
10 MM
D)
E)
F)
Estradiol production in co-culture (pg/mL)
Estrone production in co-culture (pg/mL)
Estriol production in co-culture (pg/mL)
150
800-
800
600
600
100
400
400
50
200-
200
a
DMSO
0.1 RM
0.3 RM
3 KM
10 KM
0
0
DMSO
0.1 KM
0.3 KM
3 AM
10 KM
DMSO
0,1 KM
0,3 µM
3 KM
10 µM
To determine whether the increased CYP3A7 gene expression was re- lated to the decreased estriol levels in response to the neonicotinoids, we determined the effect of estriol supplementation (using a concentration normally found in the co-culture under basal conditions) on the expres- sion of CYP3A7 in response to thiacloprid, thiamethoxam or imidacloprid. Co-treatment of H295R cells with estriol (5 ng/ml) prior to a 24-h expo- sure to thiacloprid, thiamethoxam or imidacloprid at 3 uM resulted in significantly reduced levels of CYP3A7 expression compared to the neonicotinoid treatments alone, which all increased CYP3A7 levels signif- icantly above DMSO control. In the case of imidacloprid, co-treatment with estriol reduced imidacloprid-induced CYP3A7 to levels not signifi- cantly different from DMSO control.
4. Discussion
4.1. Fetoplacental co-culture as a screening tool for endocrine disrupting chemicals
We have successfully applied our previously developed fetoplacental co-culture model as a unique screening tool to evaluate the potential en- docrine disrupting effects of a series of neonicotinoids on steroidogenesis during pregnancy. Naturally, our co-culture system has some limitations -it uses cancer cells, not primary cells and cannot fully describe the com- plex interactions that occur in vivo, but as a model of fetoplacental ste- roidogenesis it is capable of producing a variety of hormones important
A)
DHEA production in co-culture (pg/mL)
B)
Androstenedione production in co-culture (pg/mL)
C)
B-HCG production in co-culture (mlU/mL)
5000
80
200
4000
60
150-
3000
40
100
2000
1000-
20
50
0
DMSO
0.1 µM
0.3 PM
3 UM
10 gM
0
DMSO
0.1 µM
0.3 PM
3 pM
10 UM
0
DMSO
0.1 uM
0.3 gM
3 pM
10 UM
D)
E)
F)
Estradiol production in co-culture (pg/mL)
Estrone production in co-culture (pg/mL)
Estriol production in co-culture (pg/mL)
150
1000
800-
800
.
600
100
..
600-
400
50-
400
200-
200-
0
0.1 RM
0.3 RM
3 PM
10 1AM
D
0
DMSO
DMSO
0.1 µM
0.3 AM
3 pM
10 uM
DMSO
0.1 KM
0,3 µM
3 AM
10 KM
A)
B)
C)
DHEA production in co-culture (pg/mL)
Androstenedione production in co-culture (pg/mL)
B-HCG production in co-culture (mlU/mL)
5000
50
250
4000
40
200
T
3000
30
150
2000
20
100-
1000-
10-
50
0
DMSO
0.3 gM
3 gM’
10 ¿M
0
DMSO
0.3 KM
3 KM
10 KM
0
DMSO
0.3 MM
3 AM
10 KM
D)
E)
F)
Estradiol production in co-culture (pg/mL)
Estrone production in co-culture (pg/mL)
Estriol production in co-culture (pg/mL)
250
800-
800-
200-
600
600
150
400
400
100
50
200-
200
0
DMSO
0.3 KM
3 AM
10 KM
0
3 AM
0
DMSO
0.3 KM
10 JAM
DMSO
0.3 FM
3 KM
10 KM
during pregnancy. We measured aromatase activity in both the fetal (H295R) and placental (BeWo) compartments of the co-culture model with basal activity being at least 15 times higher in BeWo cells than in H295R cells (Fig. 1A-C), as previously demonstrated (Hudon Thibeault et al., 2014). This corresponds well with the in vivo situation where the placenta is responsible for the majority of CYP19 expression and estrogen biosynthesis (Mesiano and Jaffe, 1997; Hanley et al., 2001; Rainey et al., 2002; Pezzi et al., 2003).
It is well understood that estrogen production in the fetoplacental unit is dependent upon a close collaboration between the fetus and the placenta. As the human placenta does not express significant levels of CYP17 or its associated catalytic activities, it is, despite high levels of
Relative CYP3A7 expression in H295R cells (fold DMSO control)
15
10
*
*
5
0
DMSO
Thiaclopride 3 µM
Thiaclopride 10 µM
Thiamethoxame 3 M
Thiamethoxame 10 uM
Imidaclopride 3 µM
Imidaclopride 10 µM
aromatase activity, incapable of producing significant amounts of estro- gens de novo and is dependent on androgen precursors produced by the fetal adrenal and liver. During pregnancy, up to 90% of the unique pregnancy estrogen estriol is derived from fetal precursors (Gerhard et al., 1986). As previously shown, our fetoplacental co-culture model pro- duces significant quantities of estriol (Figs. 2F, 3F, 4F), whereas each cell type in monoculture produces negligible amounts (Hudon Thibeault et al., 2014), further supporting the physiological relevance of our co-cul- ture as a representative model of the fetoplacental steroidogenic unit and justifying its use as a meaningful screening tool for the effects of po- tential endocrine disrupting chemicals during pregnancy (Hudon Thibeault et al., 2017).
4.2. Disruption of fetoplacental steroidogenesis by neonicotinoid insecticides
It is widely accepted that an important number of environmental contaminants have estrogen-like activity. The most commonly studied mechanism for estrogenic effects is the binding of chemicals to the estro- gen receptor, whereby they act as (partial) agonists. This mechanism has been demonstrated for several contaminants to which pregnant women may be exposed, such as bisphenol A (Diel et al., 2002; Vivacqua et al., 2003; Heneweer et al., 2005; Wetherill et al., 2007; Chou et al., 2011). However, estrogen receptor activation is not the only possible mecha- nism by which environmental contaminants may exert pro- or antiestrogenic activity. For example, atrazine, a herbicide widely used in North America, induces aromatase activity and expression in various human cell lines (Sanderson et al., 2000, 2001, 2002; Sanderson, 2006; Fan et al., 2007; Caron-Beaudoin et al., 2016). A growing number of stud- ies have determined that neonicotinoid insecticides are potential endo- crine disruptors. A recent study showed that clothianidin, a neonicotinoid and metabolite of thiamethoxam, caused DNA fragmenta- tion in germ cells of male quails (Hoshi et al., 2014). Kapoor et al. (2011) showed that female rats exposed to neonicotinoids had lower ovarian weight, as well as LH and progesterone levels. We also previously dem- onstrated that two neonicotinoids, thiacloprid and thiamethoxam, in- duced CYP19 expression and aromatase activity in H295R cells at environmentally relevant concentrations (Caron-Beaudoin et al., 2016). In the present study, the neonicotinoids thiacloprid, thiamethoxam and
imidacloprid induced aromatase activity in H295R and BeWo cells in co- culture (Fig. 1), highlighting the tissue- and promoter-specific differ- ences in the effects of neonicotinoids on CYP19 expression, aromatase ac- tivity and estrogen biosynthesis. Beside the potential direct effects of neonicotinoids on CYP19 expression, the tested pesticides also increased the synthesis of DHEA and B-hCG (the latter an important early indicator of pregnancy), resulting in the increased production of estradiol and es- trone that we observed in the co-culture. It is known that hCG induces CAMP intracellular levels (Massicotte et al., 1981), which we have shown can increase aromatase expression and activity (Sanderson et al., 2002). Estrogen biosynthesis is, therefore, complex and cannot be ex- plained simply by the production of precursors like DHEA or androstenedione.
4.3. Possible metabolism of neonicotinoids by fetal CYP3A7
In this study, a 24-h exposure of our fetoplacental co-culture to each of the three neonicotinoids resulted in a significant decrease of estriol production (Figs. 2F, 3F, 4F). SULT2A1 and CYP3A7 are key enzymes in the fetal production of the estriol precursor 16x-hydroxyDHEA(-sul- fate). We are the first to report the presence of CYP3A7 transcript in H295R cells, the fetal compartment of our co-culture model (Figs. 5-6), and we confirmed a previous report that SULT2A1 is expressed in H295R cells (Oskarsson et al., 2006). We further found that the neonicotinoids only affected the expression of CYP3A7, which was in- creased. It is known that CYP3A4 is involved in the metabolism of neonicotinoids in human adult liver (Schulz-Jander and Casida, 2002; Dorne et al., 2005; Shi et al., 2009; Casida, 2011). Adult hepatic CYP3A4 is structurally closely related to fetal hepatic CYP3A7, sharing an amino acid sequence that is 88% similar (Komori et al., 1989; Schuetz et al., 1989; Komori et al., 1990). As fetal CYP3A7 is considered to have the same catalytic function as adult CYP3A4 (Lacroix et al., 1997), we hypoth- esize that neonicotinoid insecticides are metabolized by CYP3A7 in the fetoplacental unit, thus competing with the ability of this enzyme to pro- duce 16x-hydroxylated DHEA (and its sulfate conjugate) which are the precursors for estriol synthesis (Fig. 7).
This would explain the decreased estriol biosynthesis and the accu- mulation of DHEA in our co-culture when exposed to neonicotinoids.
Relative CYP3A7 expression in H295R cells (fold DMSO control)
150
100
#
# #
a
a
50
b
0
DMSO
Thiacloprid 3uM
Thiaclo 3uM + Estriol 5 ng/ml
Thiamethoxam 3uM
Thiamet 3uM + Estriol 5 ng/mL
Imidacloprid 3uM
Imida 3uM + Estriol 5 ng/ml
The excess androgen precursors would result in the overproduction of estrone and estradiol by the placental compartment of the co-culture, resulting in the increased levels of these two estrogens we observed (Figs. 2D, E, 3D, E, 4D, E).
We further suggest that the strong decrease in estriol levels triggers a positive feedback mechanism that increases CYP3A7 gene expression, thus explaining the CYP3A7 overexpression in H295R cells (the fetal compartment of the co-culture). To provide evidence for this hypothe- sis, we determined the effects of thiacloprid, thiamethoxam and imidacloprid on CYP3A7 expression in H295R cells supplemented with a normalizing concentration of estriol to overcome the strong suppres- sion of estriol synthesis by the neonicotinoids (Fig. 6). Estriol reversed the neonicotinoid-mediated induction of CYP3A7 mRNA expression, suggesting such a positive feedback mechanism may exist. During preg- nancy, levels of circulating estrone and estradiol increase by 100-fold. This induction reaches 1000-fold for estriol, bringing its concentration up to similar levels as the other estrogens, compared to non-pregnant women (Blackburn, 2007). To reach these levels, placental estrogens use a positive feedback mechanism, consisting of upregulating DHEA(- S) production by the fetal adrenal zone. The final result of this positive feedback is the induction of placental estrogen, including estriol (Albrecht and Pepe, 1999; Kaludjerovic and Ward, 2012). The decrease in estriol levels in the fetoplacental co-culture model exposed to neonicotinoids may activate this positive feedback mechanism, leading to overexpression of CYP3A7 in H295R cells (Fig. 5). The control of pla- cental estrogen production by this positive feedback mechanism would also explain why neonicotinoid-induced CYP3A7 expression is re- versed by a co-treatment with estriol (Fig. 6).
4.4. Implications for human health
During pregnancy, estrogens regulate uteroplacental blood flow, tro- phoblast invasion and cellular differentiation (Yashwanth et al., 2006). Disruption of estrogen biosynthesis during this critical period may im- pact the development of the fetus and placenta, as well as affect the mother’s health (Kaijser et al., 2000). For example, disruption of estrogen production has been associated with negative birth outcomes (Gerhard et al., 1986; Kaijser et al., 2000; Troisi et al., 2003). It remains unclear if environmental concentrations of neonicotinoids are sufficient to disrupt aromatase activity or hormone production (specifically estriol) in preg- nant women. Nevertheless, neonicotinoids are frequently detected in vegetables and fruits (Chen et al., 2014) and their concentrations are steadily increasing in water samples in agricultural areas in North Amer- ica, with concentrations up to 3.6 µg/L (about 0.012 uM for thiamethoxam) having been measured (Anderson et al., 2013; Main et al., 2014; Smalling et al., 2015). These widely used insecticides’ metabo- lites are also detected in the urine of farm workers at concentrations sim- ilar to those used in our experiments (up to 0.05 uM for metabolite of thiacloprid and imidacloprid) (Nomura et al., 2013). Importantly, it is suspected that ingested neonicotinoids can pass through the placental barrier (Taira, 2014), since neurobehavioral deficits were measured in rat offspring exposed in utero to these insecticides (Abou-Donia et al., 2008). Therefore, the steadily increasing use of neonicotinoid pesticides is a cause of concern for the health of pregnant women.
5. Conclusions
We applied a fetoplacental co-culture model to screen for potential endocrine disrupting effects of neonicotinoid insecticides. We found thiacloprid, thiamethoxam and imidacloprid to induce aromatase activi- ty in this in vitro model of fetoplacental steroidogenesis. The neonicotinoids increased estrone and estradiol production, while strong- ly inhibiting estriol production. We also have in direct in vitro evidence that neonicotinoids may be competing with DHEA(-S) as a substrate for CYP3A7, thus explaining the decrease in estriol production in the co-culture model. This study contributes to growing evidence of the
from maternal (V)LDL/HDL, de novo in placenta and from fetal adrenal
HO
Cholesterol
CYP11A
0
CYP17
ICH
CYP17
HO
HO
HO
17a-Hydroxypregnenolone
Dehydroepiandrosterone (DHEA)
Pregnenolone
SULT241
30-HSD 1
CYP21
Mineralo- and glucocorticolds
0,80
- Accumulation of DHEA-sulfate
DHEA-Sulfate
Progesterone
sulfataso
fetal adrenal zone
16a-hydroxylaso CYP347
- Metabolism of neonicotinoids by CYP3A7
0
sulfataso
ICH
- Saturation of CYP3A7’s active sites
- Accumulation of DHEA
HO
0,80
DHEA
150-OH-DHEA
150-OH-DHEA-S
30-HSD 1
30-HSD 1
fetal liver (H295R cell)
OH
O
170-HSD 3,5
· CH
170-HSD 2
Androstenedione
Testosterone
16a-OH-Androstenedione
CYP19
CH
CH
170-HSD 1,7
“CH
HO
- Decrease in estriol production
HO
170-HSD 2
HO
Estrone
Estradiol
Estriol
placental cyto/syncytiotrophoblast (BeWo cell)
endocrine disrupting potential of neonicotinoid insecticides. Given the importance of estrogen synthesis during pregnancy and the association between environmental contaminants and birth outcomes, the use of physiologically relevant screening tools such as our co-culture model of fetoplacental steroidogenesis is paramount for a credible evaluation of the potential health risks posed by such chemicals.
Conflicts of interest
The authors declare to have no conflicts of interest.
Acknowledgements
This research was funded by a Natural Sciences and Engineering Re- search Council of Canada Discovery grant (NSERC; no. 313313-2012) to JTS and graduate studentships from the Fonds de recherche du Québec - Nature et technologies (FRONT) and Fondation Universitaire Armand-
Frappier INRS to ECB, the Fonds de recherche du Québec - Santé (FRQS) to AHT and NSERC to RV. This study is part of Rachel Viau’s Master’s degree.
References
Abadin, H.G., Hibbs, B.F., Pohl, H.R., 1997. Breast-feeding exposure of infants to cadmium, lead, and mercury: a public health viewpoint. Toxicol. Ind. Health 13, 495-517.
Abou-Donia, M.B., Goldstein, L.B., Bullman, S., Tu, T., Khan, W.A., Dechkovskaia, A.M., Abdel- Rahman, A.A., 2008. Imidacloprid induces neurobehavioral deficits and increases ex- pression of glial fibrillary acidic protein in the motor cortex and hippocampus in off- spring rats following in utero exposure. J. Toxic. Environ. Health A 71, 119-130.
Albrecht, E.D., Pepe, G.J., 1999. Central integrative role of oestrogen in modulating the com- munication between the placenta and fetus that results in primate fetal-placental de- velopment. Placenta 20, 129-139.
Albrecht, E.D., Aberdeen, G.W., Pepe, G.J., 2000. The role of estrogen in the maintenance of primate pregnancy. Am. J. Obstet. Gynecol. 182, 432-438.
Anderson, T.A., Salice, C.J., Erickson, R.A., McMurry, S.T., Cox, S.B., Smith, L.M., 2013. Effects of landuse and precipitation on pesticides and water quality in playa lakes of the southern high plains. Chemosphere 92, 84-90.
Bal, R., Naziroğlu, M., Türk, G., Yilmaz, Ö., Kuloğlu, T., Etem, E., Baydas, G., 2012. Insecticide imidacloprid induces morphological and DNA damage through oxidative toxicity on the reproductive organs of developing male rats. Cell Biochem. Funct. 30, 492-499. Bellinger, D.C., 2013. Prenatal exposures to environmental chemicals and children’s neurodevelopment: an update. Saf. Health Work 4, 1-11.
Blackburn, S., 2007. Reproductive and developmental processes. Maternal, Fetal and Neo- natal Physiology 100-102.
Bonmatin, J .- M., Giorio, C., Girolami, V., Goulson, D., Kreutzweiser, D.P., Krupke, C., Liess, M., Long, E., Marzaro, M., Mitchell, E.A.D., Noome, D.A., Simon-Delso, N., Tapparo, A., 2015. Environmental fate and exposure; neonicotinoids and fipronil. Environ. Sci. Pollut. Res. 22, 35-67.
Caron-Beaudoin, É., Denison, M.S., Sanderson, J.T., 2016. Effects of neonicotinoids on pro- moter-specific expression and activity of aromatase (CYP19) in human adrenocorti- cal carcinoma (H295R) and primary umbilical vein endothelial (HUVEC) cells. Toxicol. Sci. 149, 134-144.
Casida, J.E., 2011. Neonicotinoid metabolism: compounds, substituents, pathways, en- zymes, organisms, and relevance. J. Agric. Food Chem. 59, 2923-2931.
Chen, M., Tao, L., McLean, J., Lu, C., 2014. Quantitative analysis of neonicotinoid insecticide residues in foods: implication for dietary exposures. J. Agric. Food Chem. 62, 6082-6090.
Chou, W .- C., Chen, J .- L., Lin, C .- F., Chen, Y .- C., Shih, F .- C., Chuang, C .- Y., 2011. Biomonitoring of bisphenol A concentrations in maternal and umbilical cord blood in regard to birth out- comes and adipokine expression: a birth cohort study in Taiwan. Environ. Health 10, 94. Decourtye, A., Devillers, J., Cluzeau, S., Charreton, M., Pham-Delègue, M .- H., 2004. Effects of imidacloprid and deltamethrin on associative learning in honeybees under semi-field and laboratory conditions. Ecotoxicol. Environ. Saf. 57, 410-419.
Diel, P., Olff, S., Schmidt, S., Michna, H., 2002. Effects of the environmental estrogens bisphenol A, o, p’-DDT, p-tert-octylphenol and coumestrol on apoptosis induction, cell proliferation and the expression of estrogen sensitive molecular parameters in the human breast cancer cell line MCF-7. J. Steroid Biochem. Mol. Biol. 80, 61-70.
Dorne, J.L.C.M., Walton, K., Renwick, A.G., 2005. Human variability in xenobiotic metabo- lism and pathway-related uncertainty factors for chemical risk assessment: a review. Food Chem. Toxicol. 43, 203-216.
Ellis, S.A., Palmer, M.S., McMichael, A.J., 1990. Human trophoblast and the choriocarcinoma cell line BeWo express a truncated HLA class I molecule. J. Immunol. 144, 731-735.
Fan, W., Yanase, T., Morinaga, H., Gondo, S., Okabe, T., Nomura, M., Komatsu, T., Morohashi, K., Hayes, T.B., Takayanagi, R., Nawata, H., 2007. Atrazine-induced aromatase expres- sion is SF-1 dependent: implications for endocrine disruption in wildlife and reproduc- tive cancers in humans. Environ. Health Perspect. 115, 720-727.
Foster, P.M.D., 2006. Disruption of reproductive development in male rat offspring follow- ing in utero exposure to phthalate esters. Int. J. Androl. 29, 140-147.
Gazdar, A.F., Oie, H.K., Shackleton, C.H., Chen, T.R., Triche, T.J., Myers, C.E., Chrousos, G.P., Brennan, M.F., Stein, C.A., La Rocca, R.V., 1990. Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50, 5488-5496.
Gerhard, I., Fitzer, C., Klinga, K., Rahman, N., Runnebaum, B., 1986. Estrogen screening in evaluation of fetal outcome and infant’s development. J. Perinat. Med. 14, 279-291.
Girolami, V., Mazzon, L., Squartini, A., Mori, N., Marzaro, M., Bernardo, A.D., Greatti, M., Giorio, C., Tapparo, A., 2009. Translocation of neonicotinoid insecticides from coated seeds to seedling guttation drops: a novel way of intoxication for bees. J. Econ. Entomol. 102, 1808-1815.
Goulson, D., 2013. Review: an overview of the environmental risks posed by neonicotinoid insecticides. J. Appl. Ecol. 50, 977-987.
Hanley, N.A., Rainey, W.E., Wilson, D.I., Ball, S.G., Parker, K.L., 2001. Expression profiles of SF-1, DAX1, and CYP17 in the human fetal adrenal gland: potential interactions in gene regulation. Mol. Endocrinol. 15, 57-68.
Health Canada, 2014. Pest control products sales report for 2010 [Internet]. Health Cana- da, Ottawa, ON Available from: http://web.archive.org/web/20141019054418/http:// www.hc-sc.gc.ca/cps-spc/pubs/pest/_corp-plan/sales-2010-ventes/index-eng.php.
Heneweer, M., Muusse, M., Dingemans, M., de Jong, P.C., van den Berg, M., Sanderson, J.T., 2005. Co-culture of primary human mammary fibroblasts and MCF-7 cells as an in vitro breast cancer model. Toxicol. Sci. 83, 257-263.
Henry, M., Béguin, M., Requier, F., Rollin, O., Odoux, J .- F., Aupinel, P., Aptel, J., Tchamitchian, S., Decourtye, A., 2012. A common pesticide decreases foraging success and survival in honey bees. Science 336, 348-350.
Honma, S., Suzuki, A., Buchanan, D.L., Katsu, Y., Watanabe, H., Iguchi, T., 2002. Low dose ef- fect of in utero exposure to bisphenol a and diethylstilbestrol on female mouse repro- duction. Reprod. Toxicol. 16, 117-122.
Hoshi, N., Hirano, T., Omotehara, T., Tokumoto, J., Umemura, Y., Mantani, Y., Tanida, T., Warita, K., Tabuchi, Y., Yokoyama, T., Kitagawa, H., 2014. Insight into the mechanism of reproductive dysfunction caused by neonicotinoid pesticides. Biol. Pharm. Bull. 37, 1439-1443.
Hu, H., 1991. Knowledge of diagnosis and reproductive history among survivors of child- hood plumbism. Am. J. Public Health 81, 1070-1072.
Hudon Thibeault, A .- A., Deroy, K., Vaillancourt, C., Sanderson, J.T., 2014. A unique co-culture model for fundamental and applied studies of human fetoplacental steroidogenesis and interference by environmental chemicals. Environ. Health Perspect. 122, 371-377.
Hudon Thibeault, A .- A., Laurent, L., Duy, S.V., Sauvé, S., Caron, P., Guillemette, C., Sanderson, J.T., Vaillancourt, C., 2017. Fluoxetine and its active metabolite norfluoxetine disrupt estrogen synthesis in a co-culture model of the feto-placental unit. Mol. Cell. Endocrinol. 442, 32-39.
Jacobson, J.L., Jacobson, S.W., Humphrey, H.E.B., 1990. Effects of in utero exposure to polychlorinated biphenyls and related contaminants on cognitive functioning in young children. J. Pediatr. 116, 38-45.
Kaijser, M., Granath, F., Jacobsen, G., Cnattingius, S., Ekbom, A., 2000. Maternal pregnancy estriol levels in relation to anamnestic and fetal anthropometric data. Epidemiology 11, 315-319.
Kaludjerovic, J., Ward, W.E., 2012. The Interplay between Estrogen and Fetal Adrenal Cor- tex. J. Nutr. Metab. 837901.
Kapoor, U., Srivastava, M.K., Srivastava, L.P., 2011. Toxicological impact of technical imidacloprid on ovarian morphology, hormones and antioxidant enzymes in female rats. Food Chem. Toxicol. 49, 3086-3089.
Komori, M., Nishio, K., Ohi, H., Kitada, M., Kamataki, T., 1989. Molecular cloning and se- quence analysis of cDNA containing the entire coding region for human fetal liver cy- tochrome P-450. J. Biochem. 105, 161-163.
Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K., Kamataki, T., 1990. Fetus-specific expression of a form of cytochrome P-450 in human livers. Biochemistry 29, 4430-4433.
Kondoh, N., Wakatsuki, T., Ryo, A., Hada, A., Aihara, T., Horiuchi, S., Goseki, N., Matsubara, O., Takenaka, K., Shichita, M., 1999. Identification and characterization of genes asso- ciated with human hepatocellular carcinogenesis. Cancer Res. 59, 4990-4996.
Lacroix, D., Sonnier, M., Moncion, A., Cheron, G., Cresteil, T., 1997. Expression of CYP3A in the human liver-evidence that the shift between CYP3A7 and CYP3A4 occurs imme- diately after birth. Eur. J. Biochem. 247, 625-634.
Leeder, J.S., Gaedigk, R., Marcucci, K.A., Gaedigk, A., Vyhlidal, C.A., Schindel, B.P., Pearce, R.E., 2005. Variability of CYP3A7 Expression in Human Fetal Liver. J. Pharmacol. Exp. Ther. 314, 626-635.
Main, A.R., Headley, J.V., Peru, K.M., Michel, N.L., Cessna, A.J., Morrissey, C.A., 2014. Wide- spread use and frequent detection of neonicotinoid insecticides in wetlands of Canada’s Prairie Pothole Region. PLoS One 9, e92821.
Massicotte, J., Borgus, J .- P., Lachance, R., Labrie, F., 1981. Inhibition of hCG-induced cyclic AMP accumulation and steroidogenesis in rat luteal cells by an LHRH agonist. J. Steroid Biochem. 14, 239-242.
Mesiano, S., Jaffe, R.B., 1997. Developmental and functional biology of the primate fetal adrenal cortex. Endocr. Rev. 18, 378-403.
Mucci, L.A., Lagiou, P., Tamimi, R.M., Hsieh, C .- C., Adami, H .- O., Trichopoulos, D., 2003. Pregnancy estriol, estradiol, progesterone and prolactin in relation to birth weight and other birth size variables (United States). Cancer Causes Control 14, 311-318.
Mylchreest, E., Wallace, D.G., Cattley, R.C., Foster, P.M.D., 2000. Dose-dependent alter- ations in androgen-regulated male reproductive development in rats exposed to di(n-butyl) phthalate during late gestation. Toxicol. Sci. 55, 143-151.
Nampoothiri, L.P., Neelima, P.S., Rao, A.J., 2007. Proteomic profiling of forskolin-induced differentiated BeWo cells: an in-vitro model of cytotrophoblast differentiation. Reprod. BioMed. Online 14, 477-487.
Nomura, H., Ueyama, J., Kondo, T., Saito, I., Murata, K., Iwata, T., Wakusawa, S., Kamijima, M., 2013. Quantitation of neonicotinoid metabolites in human urine using GC-MS. J. Chromatogr. B 941, 109-115.
Oskarsson, A., Ullerås, E., Plant, K.E., Hinson, J.P., Goldfarb, P.S., 2006. Steroidogenic gene ex- pression in H295R cells and the human adrenal gland: adrenotoxic effects of lindane in vitro. J. Appl. Toxicol. 26, 484-492.
Pezzi, V., Mathis, J.M., Rainey, W.E., Carr, B.R., 2003. Profiling transcript levels for steroido- genic enzymes in fetal tissues. J. Steroid Biochem. Mol. Biol. 87, 181-189.
Radonić, A., Thulke, S., Mackay, I.M., Landt, O., Siegert, W., Nitsche, A., 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Biophys. Res. Commun. 313, 856-862.
Rainey, W.E., Carr, B.R., Sasano, H., Suzuki, T., Mason, J.I., 2002. Dissecting human adrenal androgen production. Trends Endocrinol. Metab. 13, 234-239.
Sanderson, J.T., 2006. The steroid hormone biosynthesis pathway as a target for endocrine- disrupting chemicals. Toxicol. Sci. 94, 3-21.
Sanderson, J.T., Seinen, W., Giesy, J.P., van den Berg, M., 2000. 2-Chloro-s-triazine herbicides induce aromatase (cyp19) activity in h295r human adrenocortical carcinoma cells: a novel mechanism for estrogenicity? Toxicol. Sci. 54, 121-127.
Sanderson, J.T., Letcher, R.J., Heneweer, M., Giesy, J.P., van den Berg, M., 2001. Effects of chloro-s-triazine herbicides and metabolites on aromatase activity in various human cell lines and on vitellogenin production in male carp hepatocytes. Environ. Health Perspect. 109, 1027-1031.
Sanderson, J.T., Boerma, J., Lansbergen, G.W.A., van den Berg, M., 2002. Induction and inhi- bition of aromatase (cyp19) activity by various classes of pesticides in H295R human adrenocortical carcinoma cells. Toxicol. Appl. Pharmacol. 182, 44-54.
Schuetz, J.D., Molowa, D.T., Guzelian, P.S., 1989. Characterization of a cDNA encoding a new member of the glucocorticoid-responsive cytochromes P450 in human liver. Arch. Biochem. Biophys. 274, 355-365.
Schulz-Jander, D.A., Casida, J.E., 2002. Imidacloprid insecticide metabolism: human cyto- chrome P450 isozymes differ in selectivity for imidazolidine oxidation versus nitroimine reduction. Toxicol. Lett. 132, 65-70.
Shi, X., Dick, R.A., Ford, K.A., Casida, J.E., 2009. Enzymes and inhibitors in neonicotinoid in- secticide metabolism. J. Agric. Food Chem. 57, 4861-4866.
Shiraki, N., Yamazoe, T., Qin, Z., Ohgomori, K., Mochitate, K., Kume, K., Kume, S., 2011. Ef- ficient differentiation of embryonic stem cells into hepatic cells in vitro using a feed- er-free basement membrane substratum. PloS One 6, e24228.
Siddiqui, M., Srivastava, S., Mehrotra, P., Mathur, N., Tandon, I., 2003. Persistent chlorinated pesticides and intra-uterine foetal growth retardation: a possible association. Int. Arch. Occup. Environ. Health 76, 75-80.
Simon-Delso, N., Amaral-Rogers, V., Belzunces, L.P., Bonmatin, J .- M., Chagnon, M., Downs, C., Furlan, L., Gibbons, D.W., Giorio, C., Girolami, V., 2015. Systemic insecticides (neonicotinoids and fipronil): trends, uses, mode of action and metabolites. Environ. Sci. Pollut. Res. 22, 5-34.
Smalling, K.L., Reeves, R., Muths, E., Vandever, M., Battaglin, W.A., Hladik, M.L., Pierce, C.L., 2015. Pesticide concentrations in frog tissue and wetland habitats in a landscape dom- inated by agriculture. Sci. Total Environ. 502, 80-90.
Staels, B., Hum, D.W., Miller, W.L., 1993. Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol. Endocrinol. 7, 423-433.
Stokstad, E., 2013. Pesticides under fire for risks to pollinators. Science 340, 674-676.
Svedas, E., Nisell, H., VanWijk, M.J., Nikas, Y., Kublickiene, K.R., 2002. Endothelial dysfunc- tion in uterine circulation in preeclampsia: can estrogens improve it? Am. J. Obstet. Gynecol. 187, 1608-1616.
Taira, K., 2014. Human neonicotinoids exposure in Japan. Jpn. J. Clin. Ecol. 23, 14-24. Troisi, R., Potischman, N., Roberts, J., Siiteri, P., Daftary, A., Sims, C., Hoover, R.N., 2003. As- sociations of maternal and umbilical cord hormone concentrations with maternal, ges- tational and neonatal factors (United States). Cancer Causes Control 14, 347-355.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 research0034. 0031.
Vivacqua, A., Recchia, A.G., Fasanella, G., Gabriele, S., Carpino, A., Rago, V., Di Gioia, M.L., Leggio, A., Bonofiglio, D., Liguori, A., Maggiolini, M., 2003. The food contaminants bisphenol A and 4-nonylphenol act as agonists for estrogen receptor & in MCF7 breast cancer cells. Endocrine 22, 275-284.
Wetherill, Y.B., Akingbemi, B.T., Kanno, J., Mclachlan, J.A., Nadal, A., Sonnenschein, C., Watson, C.S., Zoeller, R.T., Belcher, S.M., 2007. In vitro molecular mechanisms of bisphenol A action. Reprod. Toxicol. 24, 178-198.
Yashwanth, R., Rama, S., Anbalagan, M., Rao, A.J., 2006. Role of estrogen in regulation of cellular differentiation: a study using human placental and rat Leydig cells. Mol. Cell. Endocrinol. 246, 114-120.