microRNA-99a inhibits cell proliferation, colony formation ability, migration and invasion by targeting fibroblast growth factor receptor 3 in prostate cancer
DEYAO WU*, YUNFENG ZHOU*, HUIXING PAN, PING QU and JIAN ZHOU
Department of Urology, The Fourth Affiliated Hospital of Nantong Medical College, Yancheng City First People’s Hospital, Yancheng, Jiangsu 224001, P.R. China
Received April 9, 2014; Accepted August 6, 2014
DOI: 10.3892/mmr.2014.2792
Abstract. microRNA-99a (miR-99a) was reported to be among the most frequently downregulated miRNAs in numerous types of human cancers, including prostate, bladder, hepato- cellular and ovarian carcinoma, squamous cell carcinoma of the tongue, squamous cell lung carcinoma as well as child- hood adrenocortical tumors. The aim of the present study was to determine the effects of miRNA-99a on cell proliferation, colony formation ability, migration and invasion in prostate cancer. Following transfection with miRNA-99a, cell viability, colony formation, cell migration and cell invasion assays were performed on prostate cancer cell lines, as well as western blot analysis and luciferase assays. miRNA-99a inhibited cell proliferation, colony formation ability, migration and invasion in DU145 and PC-3 cells, therefore indicating that miRNA-99a may have a tumor suppressive role in prostate cancer. In addi- tion, the present study provided the first evidence that the mechanism of action of miRNA-99a may proceed by directly targeting fibroblast growth factor receptor 3 in prostate cancer. In conclusion, the results of the present study suggested that miRNA-99a may have potential use as a therapeutic target for the treatment of prostate cancer.
Introduction
Prostate cancer remains one of the most prevalent types of cancer in males (1). In the USA and Europe, prostate cancer is currently the second most common cause of cancer mortality
Correspondence to: Dr Jian Zhou, Department of Urology, The Fourth Affiliated Hospital of Nantong Medical College, Yancheng City First People’s Hospital, 15 Yuehe Road, Yancheng, Jiangsu 224001, P.R. China
E-mail: luqiang0405@163.com
*Contributed equally
Key words: prostate cancer, fibroblast growth factor receptor 3, miR-99a, microRNA
in males >40 years of age, and the third most common cause of cancer-associated mortality in males (2,3). A total of 238,590 novel cases and 29,720 mortalities due to prostate cancer were estimated for 2013 in the USA (2). Although the etiology of this malignancy remains to be elucidated, several risk factors have been identified that are considered to contribute to pros- tate carcinogenesis, including hereditary and environmental components; however, age, race and family history are the only well-established risk factors (4). Early-stage cancers are managed using various treatments, including radical prostatec- tomy, radiation or hormone ablation therapy. Prostate cancer is only temporarily manageable using hormone deprivation, it will inevitably become resistant to hormonal therapy, following which there is currently no effective treatment (5). Therefore, understanding the molecular basis of prostate cancer and the development of novel treatments are crucial for improving the survival rates of prostate cancer patients.
MicroRNAs (miRNAs) are a type of endogenously expressed small, non-coding, single-stranded RNAs. miRNAs are able to negatively regulate gene expression through binding to the 3’ untranslated region (3’UTR) of their target messenger RNAs (mRNAs) (6). In mammalian cells, miRNAs affect gene silencing via translational inhibition and mRNA degradation; an individual miRNA is capable of regulating numerous distinct mRNAs. miRNAs have been estimated to regulate ~30% of the human genome (7). Hundreds of evolu- tionarily conserved miRNAs have been identified in plants, animals and viruses (7,8). These molecules have been reported to control fundamental cell functions, including proliferation, apoptosis and differentiation; this therefore indicated that they may have a role in carcinogenesis (9-11). Numerous studies have illustrated that miRNAs are aberrantly expressed in human malignancies, such as prostate cancer (12-14). Upregulated miRNAs in cancer may function as oncogenes through the negative regulation of tumor suppressor genes (15). By contrast, downregulated miRNAs have been reported to function as tumor suppressor genes and inhibit cancer devel- opment through the regulation of oncogenes (16). Therefore, the identification of the target of miRNAs may be critical for understanding the function of miRNAs in cancer development and progression. It has also been suggested that miRNAs may be useful therapeutic targets for novel cancer therapies.
miR-99a has been reported to be a frequently downregulated miRNA in numerous types of human cancers, including pros- tate, bladder, hepatocellular and ovarian carcinoma, squamous cell carcinoma of the tongue, squamous cell lung carcinoma as well as childhood adrenocortical tumors (17). A study by Sun et al (18) reported that miR-99a suppressed the expression of prostate-specific antigen and prostate cancer cell prolif- eration by targeting switch/sucrose nonfermentable-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 and subfamily D member 1 as well as the mechanistic target of rapamycin (mTOR). The aim of the present study was to determine the effects of miR-99a on cell proliferation, colony formation ability, migration and invasion in prostate cancer cell lines. In addition, the effect of miR-99a expression on fibroblast growth factor receptor 3 (FGFR3) was examined.
Materials and methods
Cells and culture conditions. The human prostate cancer cell lines DU145 and PC-3 were obtained from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). DU145 and PC-3 cells were cultured in RPMI 1640 medium (Gibco-BRL, Grand Island, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco-BRL) under a humidified atmosphere of 5% CO2 at 37℃. To propagate spheres in vitro, spheres were collected by gentle centrifugation (200 x g), dissociated into single cells, and then cultured to generate the next generation of spheres.
Transfection. Mature miR-99a mimics and miRNA mimics negative control (NC) were designed and synthesized by GenePharma(Shanghai,China).The sequenceofmiR-99amimics was 5’-AACCCGUAGAUCCGAUCUUGUG-3’. The sequence of NC mimics was 5’-UUCUCCGAACGUGUCACGUTT-3’. Cells were transfected using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manu- facturer’s instructions.
Quantitative polymerase chain reaction (qPCR) for miR-99a. Total cellular RNA was extracted using TRIzol reagent (Invitrogen Life Technologies). The RNA was stored in diethylpyrocarbonate-treated water at -80℃ and the quan- tity and quality of the samples were evaluated prior to use with an ND-1000 NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). qPCR for miR-99a was performed using a SYBRgreen microRNA assay (Genepharm, Shanghai, China) according to the manufacturer’s instruc- tions. qPCR was performed using a 7300 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) with an miR-99a primer set and double strand binding dye SYBRgreen. All primers were obtained from the TaqMan miRNA assays. GAPDH (Genepharm, Shanghai, China) was used as an internal control. Every sample was replicated three times. Data were analyzed by comparing Ct values.
Cell viability assay. Cell proliferation was determined using the MTT assay. The transfected cells (miR-99a mimics and NC) were seeded in a 96-well plate at a density of 3,000 cells per well. Cell viability assays were performed every 24 h for 5 days. In
brief, 20 ul MTT solution was added to each well and incubated at 37°℃ for 4 h. Plates were then centrifuged (200 x g, 10 min), and the purple colored precipitates of formazan were dissolved in 200 ul dimethyl sulfoxide. Absorbance was measured at 490 nm in an ELISA reader (Model 550; Bio-Rad, Richmond, CA, USA). The suppression rate was calculated using the formula: Suppression rate=(1-ODmiR-145/ODmiR-NC)x100%. Proliferation curves were drawn on the basis of mean absor- bance at each time-point. All the experiments were performed in triplicate.
Colony formation assay. The colony-forming ability of DU145 and PC-3 cells transfected with miR-99a was assessed using a colony formation assay. In brief, the transfected cells (miR-99a mimics and NC) growing in log phase were trypsinized and seeded into six-well plates with a density of 2,000 cells per well. The cells were kept in an incubator at 37℃ for seven days. On day eight, the colonies were washed with phosphate-buffered saline (PBS), fixed with formalin (10%; Beyotime Institute of Biotechnology, Haimen, China) and stained with methyl violet. Finally, the methyl violet dye was washed off with PBS. The number of colonies was counted using a micro- scope (Olympus IX53; Olympus Corporation, Tokyo, Japan). Colony-inhibition rate=[1-(number of colonies in experi- mental groups/control group)]x100%; and colony-forming efficiency=(1-colony-inhibition rate), were calculated.
Cell migration and invasion assay. Cell migration and inva- sion were assayed using Transwell chambers (8 um; Costar, Cambridge, MA, USA). For the migration assay, the trans- fected cells (miR-99a mimics and NC) growing in the log phase were trypsinized and resuspended as single cell solutions. A total of 1x105 cells per well were placed into the upper chamber cultured in medium with 2% FBS, while 500 ul medium containing 20% FBS was added to the lower chamber. For the invasion assay, a Transwell chamber coated with Matrigel® (BD Biosciences, San Jose, CA, USA) and a total of 1×105 cells were seeded into the upper chamber, while the bottom chamber was incubated with 500 ul medium containing 20% serum. Cells were incubated for 12 h for the migration assay and 24 h for the invasion assay. At the end of the experiments, the cells on the upper surface of the membrane were removed, and the migrated cells were fixed with 100% methanol (Beyotime Institute of Biotechnology) for two min, stained in 0.5% crystal violet (Beyotime Institute of Biotechnology) for two min, rinsed in PBS and then subjected to microscopic inspection (magnifi- cation, x200). Five visual fields of each insert were randomly selected and counted under a light microscope (Olympus IX53). Each condition was assayed in triplicate and each experiment repeated at least three times.
Western blot analysis. Primary antibodies used in the present study, including FGFR3 (rabbit, polyclonal) and ß-actin (rabbit, monoclonal), were purchased from Bioworld Technology (Louis Park, MN, USA). Transfected cells were washed with ice cold PBS and lysed with 1% radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology) 72 h following transfection. The protein concentration was determined using the bicinchoninic acid assay kit (Beyotime Institute of Biotechnology). Equal amounts of the proteins were separated
DU145
PC-3
1.2
1.2
Relative expression of miR-99aLog:
1.0
Relative expression of miR-99aLog2
1.0
0.8
0.8
0.6
0.6
0.4
0.4
0.2
0.2
0.0
0.0
-24
0
24
48
72
96
120
144
168
-24
0
24
48
72
96
120
144
168
Time (h)
Time (h)
by 10% SDS PAGE (Beyotime Institute of Biotechnology) and transferred to polyvinylidene difluoride membranes (Beyotime Institute of Biotechnology). The membrane was blocked with 5% skimmed milk, followed by an overnight incubation at 4℃ with a primary antibody at dilutions specified by the manufacturer’s instructions. Following washing, the membrane was incubated with the corresponding horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit; Bioworld Technology) in tris-buffered saline with Tween (Beyotime Institute of Biotechnology, China). The blot was then developed using an enhanced chemilluminescence solution (Pierce, Rockford, IL, USA) and images were captured using a FluorChem imaging system (Model number: 92-13779-00 FC2; Alpha Innotech, San Leandro, CA, USA).
Luciferase assay. The DU145 and PC-3 cells were trans- fected with 0.5 µg reporter plasmid, 40 nmol miR-99a mimics or NC in a 12-well plate using Lipofectamine 2000 according to the manufacturer’s instructions. The primers used for cloning FGFR3 mRNA 3’UTR were: Forward, GGGCTCGAGGGCCACTGGTCCCCAACAATGTG and reverse, GGGCGGCCGCCCAGTAACAGTACAGAACGA ACCAAC. Assays were performed using the Dual-Luciferase Reporter Assay system (Promega, Manheim, Germany) following 48 h of transfection. The firefly and renilla luciferase activities were measured using a TECAN Infinite 200 lumi- nometer (Tecan, Männedorf, Switzerland). The firefly luciferase activity was normalized to the renilla luciferase activity for each transfected well. To determine whether miR-99a targets the FGFR3 3’-UTR, TARGETSCAN 5.2 (www.targetscan.org) and PICTAR (pictar.mdc-berlin.de) were used to assess the comple- mentarity of miR-99a to the FGFR3 3’-UTR. Each reporter plasmid was transfected at least three times (on different days) and each sample was assayed in triplicate.
Statistical analysis. Values are presented as the mean ± stan- dard deviation. Statistical differences were analyzed using the Student’s t test. Stata 10.0 software (StataCorp LP, College Station, TX, USA) was used for statistical analysis. P<0.05
was considered to indicate a statistically significant difference between values.
Results
Relative miR-99a levels increase significantly following trans- fection into DU145 and PC-3 cells. The endogenous levels of miR-99a in DU145 and PC-3 cells as well as its levels following transfection of miR-99a were recorded every 24 h. As shown in Fig. 1, miR-99a levels were significantly increased until ~120 h following transfection in the two cell lines. The levels of miR-99a declined gradually following a peak at 24 h.
miR-99a reduces cell proliferation and colony formation ability of DU145 and PC-3 cells. An MTT assay was used in order to investigate the influence of miR-99a on cell proliferation. Upregulation of miR-99a significantly inhibited cell prolif- eration (Fig. 2A). MTT assays revealed that following 144 h of treatment, the growth suppression rate of miR-99a reached 33.42+2.5% in DU145 cells and 29.13±2.8% in PC-3 cells.
A colony formation assay was used to determine the effect of miR-99a upregulation on colony formation ability. As shown in Fig. 2B, the relative colony-formation efficiency was signifi- cantly reduced to 59.8+5.6% in DU145 cells and 38.7±6.1% in PC-3 cells. These results therefore indicated that miR-99a may have an important role in the regulation of prostate cancer DU145 and PC-3 cell lines.
miR-99a suppresses cell migration and invasion in pros- tate cancer DU145 and PC-3 cells. A Transwell assay was performed in order to measure the effect of miR-99a on tumor cell migration and invasion. Migration of miRNA-99a-trans- fected cells was significantly decreased to 47.14±5.38% in DU145 cells and 51.95±6.18% in PC-3 cells (Fig. 3A). In the invasion assay (Fig. 3B), the miR-99a groups were found to have decreased cell invasion of 55.28±6.42% in DU145 cells and 65.76±7.37% in PC-3 cells. These results indicated that miR-99a reduced migration and invasion in prostate cancer DU145 and PC-3 cell lines.
A
2.5
2.0
-* miR-99a
* miR-99a
++ miR-NC
miR-NC
Absorbance at 490nm
2.0
Absorbance at 490nm
1.5
1.5
1.0
1.0
0.5
0.5
0.0
24
48
72
96
120
144
0.0
24
48
72
96
120
144
Time (hour)
Time (hour)
DU145
PC-3
B
miR-99a
NC
miR-99a
NC
Relative colony-forming efficiency(%)
*
*
100
Relative colony-forming efficiency(%)
100
50
50-
0
0
miR-99a
NC
miR-99a
NC
DU145
PC-3
A
miR-99a
NC
miR-99a
NC
B
miR-99a
NC
miR-99a
NC
150-
150
200-
*
200-
*
*
*
Cell Number
100-
Cell Number
100-
Cell Number
150-
Cell Number
150-
100-
100-
50-
50-
50-
50-
0
0
miR-99a
NC
0
0
miR-99a
NC
miR-99a
NC
miR-99a
NC
DU145 migration
PC-3 migration
DU145 invasion
PC-3 invasion
miR-99a
NC
miR-99a
NC
FGFR3
FGFR3
B-actin
B-actin
**
*
Relative expression of FGFR3 normalized to ß -actin
Relative expression of FGFR3 normalized to ß -actin
0.9
0.9
0.6
0.6
0.3
0.3
0.0
0.0
miR-99a
NC
miR-99a
NC
DU145
PC-3
| predicted consequential pairing of target region (top) and miRNA (bottom) | |
|---|---|
| Position 537-544 of FGFR3 3' UTR hsa-miR-99a | 5 ' . CUCAGAGACUGAAAUUACGGGUA 3' GUGUUCUAGCCUAGAUGCCCAA |
A
B
120
*
120
*
100
100
Relative Luciferase activity (%)
Relative Luciferase activity (%)
80
80
60
60
40
40
20
20
0
0
miR-99a
miR-Ctrl
miR-99a
miR-Ctrl
DU145
PC-3
FGFR3 is downregulated following overexpression of miR-99a in DU145 and PC-3 cells. Western blot analysis was used to determine whether FGFR3 expression was altered following miR-99a transfection into prostate cancer DU145 and PC-3 cells. As shown in Fig. 4, the relative expression of FGFR3 was significantly downregulated in DU145 and PC-3 cell lines
following overexpression of miR-99a (P<0.05). These results indicated that miR-99a reduced protein levels of FGFR3 in prostate cancer cells.
FGFR3 is a direct target gene of miR-99a in prostate cancer. In order to determine whether miR-99a targets the FGFR3
3’-UTR, TARGETSCAN 5.2 and PICTAR were used to assess the complementarity of miR-99a to the FGFR3 3’-UTR. The results revealed that FGFR3 mRNA contained a miR-99a seven-nucleotide seed match at position 537-544 of the FGFR3 3’-UTR (Fig. 5A).
Luciferase reporter assays were performed to inves- tigate whether FGFR3 is a target of miR-99a. As shown in Fig. 5B, overexpression of miR-99a suppressed FGFR3 3’UTR-luciferase activity by 36% in DU145 cells and by 43% in PC-3 cells (P<0.05). This therefore implied that FGFR3 may be a direct target of miR-99a in vitro.
Discussion
miRNAs are major regulatory molecules that govern numerous essential cellular functions, including proliferation, differen- tiation, cell cycle control and apoptosis (19).
Dysregulation of miRNAs has been reported to result in dysregulated gene expression of oncogenes and tumor suppressor genes, subsequently leading to human diseases such as cancer (15). The miR-99 family of miRNAs is comprised of three members, miR-99a, miR-99b and miR-100; the mature sequences of these three members are located on different chromosomes (20). miR-99a is transcribed from 21q21, a region that has been reported to be commonly deleted in human lung cancers (21). The upregulation of miR-99a has also been demonstrated in childhood acute myeloid leukemia (22). However, the role of miR-99a in various malignant diseases remains to be elucidated. Previous studies have reported that the downregulation of miR-99a contributed to tumorigenesis of several types of cancer, including prostate, bladder, hepa- tocellular and ovarian carcinoma, squamous cell carcinoma of the tongue, childhood adrenocortical tumors as well as lung cancer (17). The controversial effects of miR-99a can in part be explained by miRNAs binding to numerous 3’UTRs with complementary sites and therefore having multiple downstream target proteins. The role of microRNAs in cancer may be due to target proteins that have a tumor-promoting or tumor-inhibiting function.
miR-99a expression was reported to correlate with the survival rates of hepatocellular carcinoma patients; the upregulation of miR-99a was found to suppress growth of hepatocellular carcinoma cells via targeting the downstream proteins insulin-like growth factor 1 and mTOR (23). In renal cell carcinoma, it was demonstrated that downregulation of miR-99a resulted in increased tumorigenicity through targeting of the mTOR pathway; conversely, following the upregulation of miR-99a, tumorigenicity of renal cell carci- noma cell lines was suppressed in vitro and in vivo (17). In prostate cancer, miR-99a suppressed the expression of prostate-specific antigen and may be used as an indicator of the progression of prostate cancer (18). This therefore implied that the upregulation of miRNA-99a or the production of a synthetic analogue may provide effective therapeutic targets for the treatment of tumors that result from specific oncogene activation or overexpression.
The results of the present study indicated that miR-99a may function as a tumor suppressor via the direct targeting of FGFR3 in prostate cancer. Transfection of miR-99a into pros- tate cancer cell lines resulted in decreased cell viability and
colony formation ability as well as reduced cell migration and invasion. This therefore suggested that miR-99a may have a potential therapeutic role through regulation of the oncogenic FGFR3 in prostate cancer patients.
The fibroblast growth factor (FGF) gene family consists of >19 genes encoding associated polypeptide mitogens. FGFs interact with a family of four distinct, high-affinity tyrosine kinase receptors, designated FGFR1-4 (24). FGFRs are composed of an extracellular domain that consists of three immunoglobulin-like domains and an intracellular tyrosine kinase domain. The affinity of FGF binding varies dependent on the FGFR (25); activation of FGFRs triggers different responses in different cell types, and these responses include proliferation, migration and differentiation as well as the inhi- bition of proliferation and/or cell death (26). Therefore, the role of deregulated FGF signaling in carcinogenesis has been the focus of numerous studies.
The family of FGFs and FGFRs are important in pros- tate organogenesis as well as the pathogenesis of prostate cancer (27). FGFR3 has been reported to have a major role in numerous types of cancer. The extracellular portion of FGFR3 interacts with FGF3, inducing trans autophosphory- lation at the tyrosine residues of the cytoplasmic domain and subsequently stimulating intrinsic catalytic activity and activation of downstream signaling pathways (28). Several of these FGFR3-stimulated signal transduction pathways have been implicated in oncogenesis, including the Ras/extracellular-signal-regulated kinase/mitogen-activated protein kinase, the phospholipase Cc/protein kinase C, phosphatidylinositol 3-kinase, and the signal transducers and activators of transcription pathways (29). FGFR signaling has also been reported to be involved in the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (30,31), the dysregulated activation of which is prevalent in human cancer (32,33) and closely correlates with cancer hall- marks (34).
The overexpression of FGFR3 typically occurs through mutations within its extracellular and transmembrane domains as well as through overexpression of the wild type receptor (35). Hernández et al (36) reported that the highest recorded number of FGFR3 mutations was in patients with additional tumors as well as prostate cancer, i.e. bladder, skin, and colon tumors. In bladder cancers, mutations occurred predominantly in non-muscle invasive disease and significantly less frequently in muscle-invasive lesions. This therefore indicated that these mutations may be associated with a favorable course of the disease in non-invasive papillary bladder cancer (37). In prostate cancer, FGFR3 is expressed in the majority of benign prostatic hyperplasia (BPH) and prostate cancer. The expres- sion pattern was reported to be predominantly epithelial with significant nuclear signals in BPH as well as the malignant prostate dysplasia (38). Hernández et al (36) reported an association between FGFR3 mutation frequency in low-grade prostate cancer and prostate cancer in patients with other coinciding malignancies. These results therefore indicated that FGFR3 may be a potential target for inhibition in prostate cancer.
The results of the present study revealed that miR-99a suppressed prostate cancer cell proliferation, colony forma- tion ability, migration and invasion via the downregulation of
FGFR3, therefore suggesting miR-99a and FGFR3 as targets of therapeutic drugs for prostate cancer.
In conclusion, to the best of our knowledge, the present study was the first to report that miR-99a reduced cell prolifera- tion, colony formation ability, migration and invasion through regulation of FGFR3 in prostate cancer. The identification of candidate target genes of miR-99a may help to elucidate the carcinogenic mechanisms involved in prostate cancer. The results of the present study have promising therapeutic impli- cations and therefore provide the basis for further studies for the treatment of prostate cancer. Future studies are required to address whether the potential of miR-99a may be fully real- ized in cancer treatment. If so, these may provide beneficial results for treatment of prostate cancer.
References
1. Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin 63: 11-30, 2013.
2. McGoldrick CA, Jiang YL, Paromov V, Brannon M, Krishnan K and Stone WL: Identification of oxidized protein hydrolase as a potential prodrug target in prostate cancer. BMC Cancer 14: 77, 2014.
3. Damber JE and Aus G: Prostate cancer. Lancet 371: 1710-1721, 2008.
4. Shavers VL, Underwood W and Moser RP: Race/ethnicity and the perception of the risk of developing prostate cancer. Am J Prev Med 37: 64-67, 2009.
5. Ma S, Chan YP, Kwan PS, et al: MicroRNA-616 induces androgen-independent growth of prostate cancer cells by suppressing expression of tissue factor pathway inhibitor TFPI-2. Cancer Res 71: 583-592, 2011.
6. Filipowicz W, Bhattacharyya SN and Sonenberg N: Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9: 102-114, 2008.
7. Bartel DP: MicroRNAs: target recognition and regulatory functions. Cell 136: 215-233, 2009.
8. Ambros V: The functions of animal microRNAs. Nature 431: 350-355, 2004.
9. Calin GA and Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer 6: 857-866, 2006.
10. Esquela-Kerscher A and Slack FJ: Oncomirs - microRNAs with a role in cancer. Nature Rev Cancer 6: 259-269, 2006.
11. Lu J, Getz G, Miska EA, et al: MicroRNA expression profiles classify human cancers. Nature 435: 834-838, 2005.
12. Schaefer A, Stephan C, Busch J, Yousef GM and Jung K: Diagnostic, prognostic and therapeutic implications of microRNAs in urologic tumors. Nat Rev Urol 7: 286-297, 2010.
13. Fendler A, Jung M, Stephan C, et al: miRNAs can predict prostate cancer biochemical relapse and are involved in tumor progression. Int J Oncol 39: 1183-1192, 2011.
14. Schaefer A, Jung M, Kristiansen G, et al: MicroRNAs and cancer: current state and future perspectives in urologic oncology. Urol Oncol 28: 4-13, 2010.
15. Zhou Y, Wu D, Tao J, Qu P, Zhou Z and Hou J: MicroRNA-133 inhibits cell proliferation, migration and invasion by targeting epidermal growth factor receptor and its downstream effector proteins in bladder cancer. Scand J Urol 47: 423-432, 2013.
16. Ventura A and Jacks T: MicroRNAs and cancer: short RNAs go a long way. Cell 136: 586-591, 2009.
17. Cui L, Zhou H, Zhao H, et al: MicroRNA-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinoma. BMC Cancer 12: 546, 2012.
18. Sun D, Lee YS, Malhotra A, et al: miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation. Cancer Res 71: 1313-1324, 2011.
19. Lerman G, Avivi C, Mardoukh C, et al: MiRNA expression in psoriatic skin: reciprocal regulation of hsa-miR-99a and IGF-1R. PloS One 6: e20916, 2011.
20. Sun J, Chen Z, Tan X, et al: MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma. Med Oncol 30: 411, 2013.
21. Nagayama K, Kohno T, Sato M, Arai Y, Minna JD and Yokota J: Homozygous deletion scanning of the lung cancer genome at a 100-kb resolution. Genes Chromosomes Cancer 46: 1000-1010, 2007.
22. Li XJ, Luo XQ, Han BW, Duan FT, Wei PP and Chen YQ: MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer 109: 2189-2198, 2013.
23. Li D, Liu X, Lin L, et al: MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem 286: 36677-36685, 2011.
24. Johnson DE and Williams LT: Structural and functional diversity in the FGF receptor multigene family. Adv Cancer Res 60: 1-41, 1993.
25. Kwabi-Addo B, Ropiquet F, Giri D and Ittmann M: Alternative splicing of fibroblast growth factor receptors in human prostate cancer. Prostate 46: 163-172, 2001.
26. Lafitte M, Moranvillier I, Garcia S, et al: FGFR3 has tumor suppressor properties in cells with epithelial phenotype. Mol Cancer 12: 83, 2013.
27. Dorkin TJ, Robinson MC, Marsh C, Neal DE and Leung HY: aFGF immunoreactivity in prostate cancer and its co-localization with bFGF and FGF8. J Pathol 189: 564-569, 1999.
28. Azab AK, Azab F, Quang P, et al: FGFR3 is overexpressed waldenstrom macroglobulinemia and its inhibition by Dovitinib induces apoptosis and overcomes stroma-induced proliferation. Clin Cancer Res 17: 4389-4399, 2011.
29. Wesche J, Haglund K and Haugsten EM: Fibroblast growth factors and their receptors in cancer. BiochemJ 437: 199-213, 2011.
30. Ettelaie C, Fountain D, Collier ME, Elkeeb AM, Xiao YP and Maraveyas A: Low molecular weight heparin downregulates tissue factor expression and activity by modulating growth factor receptor-mediated induction of nuclear factor-KB. Biochim Biophys Acta 1812: 1591-1600, 2011.
31. Lungu G, Covaleda L, Mendes O, Martini-Stoica H and Stoica G: FGF-1-induced matrix metalloproteinase-9 expression in breast cancer cells is mediated by increased activities of NF-kappaB and activating protein-1. Mol Carcinog 47: 424-435,2008.
32. Chaturvedi MM, Sung B, Yadav VR, Kannappan R, and Aggarwal BB: NF-KB addiction and its role in cancer: ‘one size does not fit all’. Oncogene 30: 1615-1630, 2011.
33. Perkins ND: The diverse and complex roles of NF-KB subunits in cancer. Nat Rev Cancer 12: 121-132, 2012.
34. Hanahan D and Weinberg RA: The hallmarks of cancer. Cell 100: 57-70, 2000.
35. Tomlinson DC, Hurst CD and Knowles MA: Knockdown by shRNA identifies S249C mutant FGFR3 as a potential thera- peutic target in bladder cancer. Oncogene 26: 5889-5899, 2007.
36. Hernández S, de Muga S, Agell L, et al: FGFR3 mutations in prostate cancer: association with low-grade tumors. Mod Pathol 22: 848-856, 2009.
37. Hernández S, López-Knowles E, Lloreta J, et al: Prospective study of FGFR3 mutations as a prognostic factor in nonmuscle invasive urothelial bladder carcinomas. J Clin Oncol 24: 3664-3671, 2006.
38. Gowardhan B, Douglas DA, Mathers ME, McKie AB, McCracken SR, Robson CN and Leung HY: Evaluation of the fibroblast growth factor system as a potential target for therapy in human prostate cancer. Br J Cancer 92: 320-327, 2005.