p53 tetramerization domain mutations: germline R342X and R342P, and somatic R337G identified in pediatric patients with Li-Fraumeni syndrome and a child with adrenocortical carcinoma

Lucja Fiszer-Maliszewska · Bernarda Kazanowska · Joanna Padzik . The Regional Blood Transfusion Center

Published online: 28 August 2009 @ Springer Science+Business Media B.V. 2009

Abstract Germline p53 mutations are associated with Li-Fraumeni syndrome (LFS) and other familial cancer phenotypes not fulfilling the definition for LFS. The majority of germline p53 mutations cluster in exons 5-8, corresponding to a DNA binding domain. We report the identification of two germline mutations and a somatic mutation in a tetramerization domain (TD), a rare site for mutations. The germline mutation, R342X (16915C>T), and the novel mutation, R342P (16916G>C), were found in a child with adrenocortical carcinoma and in a LFS pedi- atric patient with multiple primaries. The novel somatic mutation, R337G (16900C>G), was discovered in myelo- dysplastic syndrome with transformation to acute myelo- blastic leukemia, developing as the third primary in the LFS child. These findings add further information on p53 TD mutations and TD contribution to tumorigenesis.

Keywords Germline mutation · Li-Fraumeni syndrome . LFS · p53 gene · Somatic mutation · Tetramerization domain · TD

. Fiszer-Maliszewska () . J. Pad ☒ · Padzik

Laboratory of Tissue Immunology, Institute of Immunology and Experimental Therapy, PASci (Polish Academy of Sciences), R. Weigla 12, 53-114 Wroclaw, Poland e-mail: fiszer@iitd.pan.wroc.pl

B. Kazanowska Department of Pediatric Bone Marrow Transplantation, Oncology and Hematology, Wroclaw Medical University, Wroclaw, Poland

The Regional Blood Transfusion Center Wroclaw, Poland

Abbreviations

ACCAdrenocortical carcinoma
AMLAcute myeloblastic leukemia
DBDDNA binding domain
LFS/LFLLi-Fraumeni and Li-Fraumeni like syndromes
MDSMyelodysplastic syndrome
OSOsteosarcoma
RMSRhabdomyosarcoma
RTReverse transcription
TDTetramerization domain

Introduction

Germline mutations of the p53 tumor suppressor gene have been associated with Li-Fraumeni syndrome (LFS; MIM no. 151623 [27]) [1-4]. Such patients have strong family histories of bone and soft tissue sarcomas, brain tumors, breast cancers, and leukemias. In addition, a rare pediatric cancer, adrenocortical carcinoma (ACC) has also been frequently found in germline p53 mutation carriers [5, 6]. Comparison of the cancer distribution in LFS families with and without germline p53 mutations shows the presence of ACC in the former group, indicating that ACC is a char- acteristic feature of a phenotype determined by inherited p53 alterations [4, 7]. Constitutional p53 mutations have also been reported in various familial cancer aggregations not fulfilling the criteria for LFS of which Li-Fraumeni like syndrome (LFL) resembles “classical” LFS [7-13]. However, the estimated frequency of germline p53 muta- tions is 50-70% in LFS families and even higher in chil- dren with ACC; in contrast, in other familial cancer aggregations the frequency varies markedly and is in the

range of 20-40% in the case of LFL. It is now clear that LFS is not a synonym for the cancer phenotype with underlying germline p53 mutations. Although the clinical definition of LFS seems to be useful clinically, the criteria are likely to be changed taking into consideration the molecular basis of the syndrome [14].

The majority of somatic and germline p53 mutations have been identified in the DNA binding domain (DBD) and relatively few have been found in the N- and C-termini (IACR TP53 mutation database [27]), including a well- conserved fragment of the latter encoding the tetramer- ization domain (TD). Recent findings on the functionality of p53 mutants have shown that different mutations, even at the same position, may lead to proteins which are either inactive or display partial activity, and that applies to both DBD and TD mutants [15]. Analyses of genotype-pheno- type associations showed a prevalence of brain tumors in carriers of mutations in the DNA-binding loops, L2/L3, and in turn ACC in carriers of non-DNA-binding domain mutations [7, 16]. Detailed analyses of functional proper- ties of p53 mutants and cancer phenotypes revealed that severe clinical features and poor outcomes are related to germline mutations encoding for transcriptionally inactive p53 proteins [17].

Our previous search involving germline p53 mutations in Polish high-risk groups comprised a considerable num- ber of cancer phenotypes; however, no mutations were found [18]. In this paper, we report two germline p53 mutations, R342X and R342P, and a somatic change, R337G, found in a child with ACC (a phenotype suggestive of LFS) and in LFS patients.

Materials and methods

Subjects

In the paper we present three pediatric cancer patients in whom p53 mutations were detected. Two of the patients are members of LFS families and the third patient was diagnosed with ACC and was enrolled in the study because of the strong association between this rare pediatric cancer and germline p53 mutations [4-7]. The children were from the Low Silesia region of Poland and at the time of the study they were treated at the Department of Pediatric Bone Marrow Transplantation, Oncology and Hematology of Wroclaw Medical University in Wroclaw, Poland. After their parents signed informed consent form, the patients’ blood samples were collected, and if possible, blood sam- ples from the parents and siblings were also obtained. To verify a mutation, the newly collected blood samples were used. In case of LFS patient 263-III:2, lymphocytes obtained from peripheral blood at the MDS, AML stage

were immortalized by EBV and were used as an additional testing material. Blood samples of 100 blood donors (Regional Blood Transfusion Center, Wroclaw, Poland) with no history of family cancer who had signed an informed consent form were used as healthy controls. The study and its associated informed consent were approved by the local ethics committee.

p53 mutational analysis

DNA was extracted from blood samples using a QIAamp DNA blood mini kit (Qiagen, Hilden, Germany). The strategy used to screen for p53 (GenBank: NC_000017.9 [27]) mutations was based on PCR amplification of exons 2-11 and SSCP pre-screen, as previously described [18]. In brief, a separate pair of flanking intronic primers was used to amplify each exon, except for exon 5, in which two partially overlapping PCR fragments were studied. The cycling conditions were 94℃ for 5 min, 35 cycles of 94℃ for 30 s, 55-59ºC for 35 s, and 70℃ for 40 s, and a final extension at 72℃ for 5 min. PCR products were subjected to SSCP analysis on 6% polyacrylamide gels with and without 10% glycerol. Amplicons showing abnormally migrating bands were sequenced. PCR amplifications were performed using either the forward or reverse primer with the M13 (Rev) universal sequence tail at the 5’ end. The primer pairs used for exon 10 were as follows: Ex10-M13-F (forward), 5’-CAGGAAACAGCTATGACCGGTACTGTG AATATACTTACTTCTCC and Ex10-R (reverse), 5’-CAG GATGAGAATGGAATCCTATGGCTTTCC or Ex10-F, 5’-CA GGTACTGTGAATATACTTACTTCTCC and Ex10-M13-R, 5’-CAGGAAACAGCTATGACCGATGAGAATGGAATC CTATGGC. Direct cycle sequencing reactions were per- formed and analyzed on an ABI 3730 genetic analyzer (Applied Biosystems, Foster City, CA, USA) at the Insti- tute of Biochemistry and Biophysics, PASci, Warsaw, Poland (http://oligo.ibb.waw.pl).

p53 RT-PCR

Leukocytes separated from peripheral blood samples by gradient centrifugation with Ficoll-Paque (Lymphoflot, Biotest, Dreieich, Germany) were used for RNA isolation with a RNeasy mini kit (Qiagen, Hilden, Germany). Con- version to cDNA was done using a Sensiscript RT kit (Qiagen, Hilden, Germany). The cDNA synthesis reaction consisted of 20-50 ng of RNA, 1x RT buffer, 0.5 mM of each dNTP, 1 µM of oligo-dT primer, 10 units of RNase inhibitor, and 1 ul of Sensiscript reverse transcriptase. p53 expression analysis, subsequent to cDNA synthesis, was performed using primers complementary to the sequences of exons 8 and 11, and modified at the 5’ end with the M13 (Rev) universal sequence tail (Ex8-M13-F, 5’-CAGGAAA

2 Springer

CAGCTATGACCGGTAATCTACTGGGAC and Ex11-R, 5’-GGGGAGGGAGGCTGTCAGTG; or Ex8-F, 5’-GGTA ATCTACTGGGACGGAACAGC and Ex11-M13-R, 5’-CA GGAAACAGCTATGACCGGGGAGGGAGGCTGTCAGTG). The cycling steps were 94℃ for 5 min, 38 cycles of 94℃ for 30 s, 60℃ for 35 s, and 70°℃ for 45 s, and a final extension of 72℃ for 5 min. PCR products were checked on 6% polyacrylamide gels and then subjected to direct cycle sequencing (as above).

Results

The details of cancer phenotypes and detected p53 muta- tions are summarized in Table 1 and the pedigrees of LFS families are shown in Fig. 1. In the studied pediatric patients, two germline mutations and one somatic mutation were identified in the TD of the p53 gene. Because of the rarity of TD alterations, DNA samples of 100 healthy controls were studied in parallel; however, no mutation was found. A germline p53 mutation was identified in the proband of LFS family 630, diagnosed with a biphasic synovial sarcoma at the age of 8 years and an osteosarcoma (OS) at 12 years of age (Fig. 1). The G>C alteration at genomic position 16,916 (codon 342 CGA>CCA) causing a substitution of arginine with proline (Table 1; Fig. 2a) appeared to be a novel missense germline mutation (reported before as a somatic mutation; IARC TP53 mutation database [27]). The heterozygous mutation was confirmed both in DNA and RNA at the diagnosis of the second primary tumor (OS). The alteration was passed obligatorily by his father, who died of OS at the age of 29 years (the mother had wild p53). Another germline p53 mutation, C>T, at position 16,915 generating the change R342X (CGA>TGA), was discovered in patient 644 diagnosed with ACC metastasizing to the lungs at 12 years of age (Table 1; Fig. 2b; listed as germline and somatic mutations in the IARC TP53 mutation database). The patient did not respond to treatment and died soon after diagnosis. The alteration might be considered a de novo

Fig. 1 Pedigrees of LFS families 630 and 263. Circles represent females and squares represent males. Solid symbols are for cancer- affected subjects (diagnoses are given with age at onset) and a dash is for deceased. Probands are designated with arrows. AML acute myeloblastic leukemia, Br breast cancer, FRO female reproductive organ cancer, Leu leukemia, MDS myelodysplastic syndrome, OS osteosarcoma, RMS rhabdomyosarcoma, Synov Sa biphasic synovial sarcoma

LFS Family 630

LFS Family 263

I:1 FRO

I:2

I:1

I:2

Br, 36

II:1

II:2 LEU, 42

II:1

II:2

II:3

II:4

Br, 34

Br, 34

MI:1 II:2

OS, 29

III:1

III:2

III:3 MI:4 III:5

IV:1 IV:2 Synov Sa, &

Brain, 5

RMS, 4 RMS, 2 0$, 11

OS, 12

MDS (AML) 15

germline mutation, as no history of cancer was reported in the family. In addition, the novel somatic p53 mutation, R337G, was discovered in MDS, AML in LFS patient 263- III:2 (Fig. 1). As MDS transforming to AML was the third primary neoplasm diagnosed in the child, the mutation might be therapy-induced (Fig. 1). The child developed RMS at 4 years of age and was treated with radio- and chemotherapy. After 6 years of remission, OS developed in the irradiated area of the jaw and the girl was treated with surgery and chemotherapy. Approximately 3 years after the end of therapy, at the age of 15, she was diagnosed with MDS transforming to AML; in the FAB classification, refractory anemia with an excess of blasts (RAEB-T). At this stage of disease, along with cytogenetic alterations, the heterozygous somatic p53 mutation 16900C>G, corre- sponding to the codon 337 change CGC>GGC (R337G), was detected in DNA (Table 1; Fig. 2c). At the RNA level, preferential expression of the mutant allele 337G was

Table 1 Cancer phenotypes and identified p53 mutations
FamilyPatientCancer phenotypeª (age, years)SexMutationGenomic nucleotideCodon, base changeAA changeb
LFSº 630Proband, IV-1Synovial sa (8), OS (12)MGermline16,916342, CGA>CCAR to P
644ProbandACC (12)MGermline16,915342, CGA>TGAR to X
LFS 263Proband, III-2RMS (4), OS (11), MDS, AML (15)FSomaticd16,900337, CGC>GGCR to G

a Age at cancer diagnosis. Sa sarcoma, OS osteosarcoma, ACC adrenocortical carcinoma, RMS rhabdomyosarcoma, MDS myelodysplastic syndrome, AML acute myeloblastic leukemia

b Amino acid change (R, arginine; P, proline; X, stop codon; G, glycine)

· LFS Li-Fraumeni syndrome, classified according to the clinical definition [1]

d Somatic p53 mutation detected in developing MDS, AML

Fig. 2 Direct sequencing of the p53 gene showing mutations in the TD. a Index patient IV:1 of LFS family 630 affected by biphasic synovial sarcoma and OS was heterozygous at codon 342 with the germline G>C transversion, CGA>CCA, resulting in the R to P change. b Patient 644 with ACC carried the germline mutation CGA342TGA, corresponding to the change R>X. c Index patient

A

G

A G

AT

?

C

C

N

A

G

A

G

C

T

G

A

A

a

C

GGGCGTGAGNG CTTC GAGA

K

III:2 of LFS family 263 affected by multiple primaries; at the stage of MDS > AML, in genomic DNA the heterozygous somatic mutation at codon 337 CGC>GGC, with predicted alteration R>G was shown; d and in mRNA an expression of mutated 337G (GGC) allele was observed

B

G

A

G

A

T

G

T

T

C

G

G

A

G

C

G

A

A

D

GGGC GTGAG GG C TTC GAGA

observed, with wild allele 337R being at a background level (Fig. 2d). The mutation was present only in a myeloid lineage since EBV-immortalized B lymphocytes did not carry it. The somatic origin of the mutation R337G was confirmed by subsequent tests showing that it was neither present in patient’s blood samples obtained earlier at the diagnosis of OS nor in her affected brother’s (individual 263-III:3) blood.

Discussion

To date, only two germline mutations of the p53 gene have been reported in Poland. Both alterations were detected in adult patients with multiple primaries who appeared to be members of LFS/LFL families [19, 20]. It is in contrast to the relatively frequently detected germline BRCA1 muta- tions in breast/ovarian cancer families [20], a cancer phe- notype to some extent overlapping with LF syndromes [4, 7, 10]. In the present paper, we have described two other germline p53 mutations discovered in pediatric can- cer patients. The nonsense change, R342X, and the novel missense alteration, R342P, were identified, respectively, in a child with ACC and in a proband of a “classic” LFS family (Table 1; Fig. 1), thus in cancer phenotypes typical for germline p53 mutations [4, 7]. It is of note that the two germline mutations and the novel somatic alteration, R337G, found in MDS > AML in the LFS patient, were all identified in the TD, a rarely mutated region of p53. It

seems worth mentioning that in our previous study on p53, 1 of 9 (11%) somatic mutations found in pediatric malig- nancies, namely L330R, was also in the TD [18]. According to data on the functionality of mutant proteins, these mutations encoded for non-functional proteins [15, 21, 27].

The TD of the p53 is a well conserved region of the C-terminus and some of its mutants, especially in an x-helical domain, are non-functional or display partial activity [15, 21, 22]. Mutations at positions 337 and 342 were previously reported both as germline and somatic alterations (IACR TP53 mutation database). The codon 342 truncating mutation (R>X) is the most frequent mutation outside DBD, detected in various types of cancers. In germline, it was found in an English LFS family in asso- ciation with breast cancers, brain tumor, and RMS, and recently it was reported in a Czech LFL family in associ- ation with ACC and brain tumor (IACR TP53 database: dataset of germline mutations, Ref. ID 91, 178). Herein we also report on the R342X germline mutant in relation to ACC development in patient 644 (Table 1). The case seems to be non-syndromic and the mutation might be considered a de novo germline alteration. The novel con- stitutional mutation, R342P, we describe in the paper, has been discovered in the LFS family proband 630-IV:1 with multiple primaries (Table 1). In a 4-year period, the boy developed biphasic synovial sarcoma, which is unusual for LFS and the second primary, OS. Treatment of synovial sarcoma consisted of surgery, radiotherapy, and

chemotherapy. OS did not develop in the irradiated area, thus its growth might relate to applied chemotherapy or be an independent event. No other affected member of the family was available for testing, therefore we could not confirm that the mutation segregated with the disease. However, as it was the only p53 change discovered in the index patient, we assume that it was causally related to cancer susceptibility. Data in the IACR TP53 mutation database of somatic mutations [27] and our results (Table 1; Fig. 1) show that spectrum of neoplasms likely to be associated with the mutant R342P includes LFS char- acteristic ones as OS, leukemia, breast cancer, and less frequent female reproductive organ cancer as well as atypical tumors, Ewing sarcoma and biphasic synovial sarcoma.

In this paper, we also report the novel somatic mutant, R337G, identified in MDS > AML, the third primary in the index LFS patient 263-III:2 (Fig. 1). As the mutation was not present in patient’s blood samples collected at the diagnosis of the second primary tumor, OS, nor in her RMS-affected brother, its origin has to be somatic. The heterozygous status of the mutation, CGC/GGC, was either present in transformed cell DNA or was observed due to the admixture of normal leukocytes in studied blood sam- ples (Fig. 2c). Nonetheless, at RNA level preferential expression of the mutant allele 337G was shown with wild allele 337R being at a background level (Fig. 2d). The observed allelic imbalance might be an effect of much higher stability of the mutant mRNA or as mentioned above, an absence of wild allele in transformed cells. Transcriptional activity of the novel p53 mutant 337-gly- cine was already examined in yeast assays and shown to be non-functional with all studied promoters [15]. For comparison, substitutions of 337-arginine with leucine or proline abolished DNA binding and the mutants were non- functional, whereas the cysteine mutant retained partial activity and in particular, the mutant 337-histidine exhib- ited almost wild-type activity [15, 22, 27].

Recent findings on the role of tetramerization in p53 function indicate that the TD is essential for DNA binding, transcriptional activity, cellular localization, ubiquitina- tion, and degradation of p53 [23-26]. The experimental data also show that alterations at conserved positions of TD lead to mutants, which depending on biochemical proper- ties of the amino acid substitutions, have lost all or some of wild-type p53 functions [15, 21, 22, 27]. The reported mutants, R337G and R342P, were shown to encode for inactive p53 proteins and R342X like other nonsense mutations was assumed to be deleterious for p53 [15, 21]. Detailed analysis of available data on transcriptional activity of germline p53 mutants and associated cancer phenotypes carried out by Monti et al. [17] showed that mutant functional characteristics determines clinical

features and outcomes. Overall, families and patients with severe deficiency alleles had a higher frequency of multiple neoplasms and a lower mean age of disease onset. In contrast, patients carrying partial deficiency alleles were shown to have milder disease, that is a lower frequency of multiple cancers and a delayed disease onset (which seems to relate to different neoplasm spectrum). Monti et al. [17] classified all mutants that lead to a truncated protein as obligate severe deficiency alleles. Patients with such alleles had clinical phenotypes between the above two groups. The few severe and partial deficiency alleles of the p53 TD included in the analysis seem to determine the same clin- ical phenotypes as DBD mutants. On the basis of the cri- teria defined by Monti et al. [17], the germline mutants we have described here, R342P and R342X, would be classi- fied as severe and obligate severe deficiency alleles. The clinical features observed in patients 630 and 644, carriers of these mutants, seem to be consistent with the findings of Monti et al. [17].

In conclusion, in Polish LFS pediatric patients and a non-syndromic child with ACC, three p53 alterations were discovered in the TD, a rare site for mutations. Of the three mutations, R342P is the novel germline mutant and R337G is the novel somatic one. The constitutional mutations, R342P and R342X, were detected in the LFS child with multiple primaries and the child with ACC, respectively, that is in phenotypes characteristic for germline p53 mutations. The reported findings add more information on the TD mutations and draw one’s attention to a contribu- tion of the TD mutants to tumorigenesis in LF syndromes and cancer development in children. Given the rarity of TD mutations, the two germline and two somatic mutations discovered in Polish pediatric patients (Table 1) [18] are in excess in relation to the numbers in the databases.

Acknowledgments We thank Dr. Maria Łuczywo-Rudy of The Regional Blood Transfusion Center in Wroclaw who provided control blood samples. The study was supported by the Institute of Immu- nology and Experimental Therapy, PASci, Wroclaw, Poland.

Conflict of interest The authors indicated no potential conflicts of interest.

References

1. Li FP, Fraumeni JF Jr, Mulvihill JJ et al (1988) A cancer family syndrome in twenty-four kindreds. Cancer Res 48:5358-5362

2. Malkin D, Li FP, Strong LC et al (1990) Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 250:1233-1238

3. Srivastava S, Zou ZQ, Pirollo K et al (1990) Germ-line trans- mission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 348:747-749

4. Varley JM (2003) Germline TP53 mutations and Li-Fraumeni syndrome. Hum Mutat 21:313-320

5. Sameshima Y, Tsunematsu Y, Watanabe S et al (1992) Detection of novel germ-line p53 mutations in diverse-cancer-prone fami- lies identified by selecting patients with childhood adrenocortical carcinoma. J Natl Cancer Inst 84:703-707

6. Ribeiro RC, Sandrini F, Figueiredo B et al (2001) An inherited p53 mutation that contributes in a tissue-specific manner to pediatric adrenal cortical carcinoma. Proc Natl Acad Sci USA 98: 9330-9335

7. Olivier M, Goldgar DE, Sodha N et al (2003) Li-Fraumeni and related syndromes: correlation between tumor type, family structure, and TP53 genotype. Cancer Res 63:6643-6650

8. Birch JM, Hartley AL, Tricker KJ et al (1994) Prevalence and diversity of constitutional mutations in the p53 gene among 21 Li-Fraumeni families. Cancer Res 54:1298-1304

9. Chompret A, Brugieres L, Ronsin M et al (2000) P53 germline mutations in childhood cancers and cancer risk for carrier indi- viduals. Br J Cancer 82:1932-1937

10. Nichols KE, Malkin D, Garber JE et al (2001) Germ-line p53 mutations predispose to a wide spectrum of early-onset cancers. Cancer Epidemiol Biomarkers Prev 10:83-87

11. Rapakko K, Allinen M, Syrjäkoski K et al (2001) Germline TP53 alterations in Finnish breast cancer families are rare and occur at conserved mutation-prone sites. Br J Cancer 84:116-119

12. Siddiqui R, Onel K, Facio F et al (2005) The TP53 mutational spectrum and frequency of CHEK2*1100delC in Li-Fraumeni- like kindreds. Fam Cancer 4:177-181

13. Bougeard G, Sesboüé R, Baert-Desurmont S et al (2008) Molecular basis of the Li-Fraumeni syndrome: an update from the French LFS families. J Med Genet 45:535-538

14. Olivier M, Petitjean A, Marcel V et al (2009) Recent advances in p53 research: an interdisciplinary perspective. Cancer Gene Ther 16:1-12

15. Kato S, Han SY, Liu W et al (2003) Understanding the function- structure and function-mutation relationships of p53 tumor sup- pressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci USA 100:8424-8429

16. Petitjean A, Mathe E, Kato S et al (2007) Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phe- notype: lessons from recent developments in the IARC TP53 database. Hum Mutat 28:622-629

17. Monti P, Ciribilli Y, Jordan J et al (2007) Transcriptional func- tionality of germ line p53 mutants influences cancer phenotype. Clin Cancer Res 13:3789-3795

18. Fiszer-Maliszewska L, Czernik J, Sawicz-Birkowska K et al (2000) Screening for germline p53 mutations in pediatric and adult patients of high-risk groups in Poland. Arch Immunol Ther Exp 48:309-315

19. Rieske P, Zakrzewska M, Biernat W et al (2005) Atypical molecular background of glioblastoma and meningioma devel- oped in a patient with Li-Fraumeni syndrome. J Neurooncol 71: 27-30

20. Grzybowska E, Zientek H, Jasinska A et al (2000) High fre- quency of recurrent mutations in BRCA1 and BRCA2 genes in Polish families with breast and ovarian cancer. Hum Mutat 16: 482-490

21. Rollenhagen C, Chène P (1998) Characterization of p53 mutants identified in human tumors with a missense mutation in the tet- ramerization domain. Int J Cancer 78:372-376

22. DiGiammarino EL, Lee AS, Cadwell C et al (2002) A novel mechanism of tumorigenesis involving pH-dependent destabili- zation of a mutant p53 tetramer. Nat Struct Biol 9:12-16

23. Miller M, Lubkowski J, Rao JK et al (1996) The oligomerization domain of p53: crystal structure of the trigonal form. FEBS Lett 399:166-170

24. Jackson P, Mastrangelo I, Reed M et al (1998) Synergistic tran- scriptional activation of the MCK promoter by p53: tetramers link separated DNA response elements by DNA looping. Onco- gene 16:283-292

25. Chène P (2001) The role of tetramerization in p53 function. Oncogene 20:2611-2617

26. Tidow H, Melero R, Mylonas E et al (2007) Quaternary structures of tumor suppressor p53 and a specific p53 DNA complex. Proc Natl Acad Sci USA 104:12324-12329

27. Online database: IARC TP53 Mutation Database: dataset of germline mutations, dataset of somatic mutations (R13, 2008), Lyon. http://www-p53.iacr.fr. Cited 3 Nov 2008. LFS 1: Online Mendelian Inheritance in Man (MIM) no. 151623: http://www. ncbi.nlm.nih.gov/omim/. p53 genomic reference sequence: GenBank NC_000017.9 (NC_000017 from 7512445 to 7531642). Cited 3 March 2008