ELSEVIER
Contents lists available at ScienceDirect
European Journal of Pharmacology
journal homepage: www.elsevier.com/locate/ejphar
A
european journal of pharmacology an international journal ep
Molecular and Cellular Pharmacology
Azelnidipine inhibits aldosterone synthesis and secretion in human adrenocortical cell line NCI-H295R
Tsuyoshi Isaka ª,1, Keiichi Ikeda b,*,1, Yuko Takada a,1, Yuri Inada ª, Katsuyoshi Tojo ª, Naoko Tajima ª
ª Division of Diabetes and Endocrinology, Department of Internal Medicine, the Jikei University School of Medicine,Tokyo, 105-8461, Japan
b Department of Pharmacology, the Jikei University School of Medicine, Tokyo, 105-8461, Japan
ARTICLE INFO
Article history: Received 14 July 2008
Received in revised form 21 November 2008 Accepted 18 December 2008
Available online 10 January 2009
Keywords: Aldosterone Azelnidipine
H295R adrenocortical cell
Efonidipine Nifedipine
ABSTRACT
Blockade of a mineralocorticoid receptor is a clinically useful approach to the prevention of cardiovascular disease. The present study was designed to evaluate the effect of azelnidipine, a unique dihydropyridine Ca2+ channel blocker, on aldosterone production in the human adrenocortical cell line NCI-H295R. Azelnidipine inhibited angiotensin II- and KCI-induced expression of steroid 11ß-hydroxylase, steroid 18-hydroxylase, and the &1H subunit of the T-type Ca2+ channel, and suppressed steroid biosynthesis in H295R cells by the same amount as efonidipine. On the basis of these findings, azelnidipine appears to suppress steroid biosynthesis in H295R cells beyond the blockade of L-type calcium channels.
@ 2009 Elsevier B.V. All rights reserved.
1. Introduction
Blockade of a mineralocorticoid receptor is a clinically useful approach to the prevention of cardiovascular diseases, such as hypertension, cardiac failure, and atherosclerosis (Fiebeler et al., 2007; George and Struthers, 2007; Rader and Daugherty, 2008; Unger et al., 2008), and primary aldosteronism is recognized as a common cause of secondary hypertension (Schirpenbach and Reincke, 2007). Aldosterone biosynthesis is regulated by angiotensin II and/or extracellular K+ and is mediated mainly by Ca2+ influx into adrenal glomerulosa cells, especially through T-type Ca2+ channels (Rossier et al., 1998). A recent study showed that efonidipine and benidipine, dual T-type/L-type Ca2+ channel blockers, inhibited angiotensin II-induced and KCl-induced aldosterone biosynthesis in human adrenocortical cell line NCI-H295R, and that the effect of nifedipine, an L-type Ca2+ channel blocker, was much less potent (Okayama et al., 2006). Azelnidipine, a newly developed L-type Ca2+ channel blocker, has been reported to possess unique anti-atherogenic properties; inhibition of angiotensin II- mediated growth-promoting signaling in vascular smooth muscle cells, and an anti-oxidant effect in microvascular endothelial cells (Li et al., 2005; Matsui et al., 2005; Wellington and Scott, 2003). In addition, azelnidipine has beneficial effects on renal function (Oizumi et al., 1989; Yagil et al., 1994), and down-regulates the gene expression of molecular components of the renin-angiotensin-aldosterone system (Nakamura et al., 2006). One of the effects of azelnidipine on renal function is an
increase of sodium excretion (Yagil et al., 1994), which may be caused by an antagonistic action against aldosterone or other mechanisms. Aldosterone is well known as one of the pathological agents of the cardiovascular system, and the results of recent studies on Ca2+ channel blockers and aldosterone implied that azelnidipine may also suppress the action of aldosterone. Therefore, the present study was designed to elucidate the effect of azelnidipine on aldosterone by investigating the effects of azelnidipine on aldosterone biosynthesis in H295R cells.
2. Materials and methods
The NCI-H295R cell line was obtained from the American Type Culture Collection (ATCC, Manasas, VA, USA) and cultured in maintenance medium (Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Invitrogen Co., Carlsbad, CA, USA) containing 5% (v/v) fetal bovine serum (FBS, Invitrogen Co), 6.25 mg/l transferrin, 6.25 mg/l insulin, 1.25 g/l bovine serum albumin (BSA, Sigma-Aldrich Co., St. Louis, MO, USA), and antibiotics (penicillin and streptomycin)). The cells were maintained at 37 ℃ under a humid atmosphere of 95% air, 5% CO2 as described (Imagawa et al., 2006; Lesouhaitier et al., 2001). When they reached confluence, the cells were removed by trypsinization and plated at a density of 2.0x 106 cells/well in maintenance medium in 6-well plates, and incubated at 37 ℃ for 24 h. This medium was replaced with medium containing angiotensin II (10-7 mol/l) or KCI (10 mmol/l) and 0.1% (v/v) dimethyl sulfoxide (DMSO) with or without Ca2+ channel blockers azelnidipine (generously provided by Daiichi-Sankyo Co., Ltd., Tokyo, Japan), efonidipine (gener- ously provided by Shionogi & Co., Ltd., Osaka, Japan), and nifedipine (Sigma-Aldrich, Inc., MO, USA), and incubated at 37 ℃ for 24 h. H295R cells in DMEM/F12 medium were also incubated at 37 ℃ with or without H2O2
* Corresponding author. Tel .: +81 3 3433 1111; fax: +81 3 5473 1428.
E-mail address: ikedak@jikei.ac.jp (K. Ikeda).
1 These authors contributed equally to this work.
(0.75 mmol/l, Wako Pure Chemical Industries, Ltd., Osaka, Japan) (Saito et al., 2001), and/or azelnidipine.
To evaluate the expression of steroid 11ß-hydroxylase (CYP11B1), steroid 18-hydroxylase (CYP11(2), and the &1H subunit of T-type Ca2+ channel mRNAs, the cells were harvested using ISOGEN (Nippon Gene Co., Tokyo, Japan) and the total cellular RNA was extracted using the isothiocyanate-acid phenol/chloroform method. cDNA was synthe- sized with a Total RNA Prime Script RT reagent kit (Takara Bio, Inc., Otsu, Japan), and used for real-time PCR with SYBER PremixEX Taq (Takara Bio, Inc.) and a Thermal Cycler Dice (Takara Bio, Inc.). Specific primers for real-time PCR were as follows:
CYP11B1:
forward GATTGGGCCAACAAGGACTCA
reverse AAGGCAGGTTCACGCAGGA
CYP11ß2:
forward TCAGGGACTCAGGCCAGTCA
reverse TCTGAGGTCTGTGCACCTTGTTG
the &1H subunit of the T-type Ca2+ channel:
forward CCTCAACTGCGTCACCATCG
reverse GAGACGCTGAGGAAGACC
glyceraldehyde-3-phosophate dehydrogenase: forward GAAGGTGAAGGTCGGAGTC
reverse GAAGATGGTGATGGGATTTC
The annealing temperature in all experiments was 60 ℃. Quantita- tive data were normalized with respect to the amount of GAPDH mRNA. The quality of PCR products was confirmed via dissociation curves and the data were analyzed by the 2-44CT method using the 2nd derivative curve of amplification plots (Thermal Cycler Dice Real Time System TP800 software version 2.00B, TaKaRa Bio, Inc.) (Livak and Schmittgen, 2001). Western blotting analysis was used to evaluate the mRNA of steroid synthetase. Briefly, H295R cells were lysed by M-PER Mamma- lian Protein Extraction Reagent (Pierce Biotechnology, Inc., Rockford, IL, USA) and proteins were electrophoresed by sodium dodecyl sulfate poly-acrylamide gel. The proteins were subsequently transferred onto a polyvinylidene difluoride membrane (Invitrolon PDVF, Invitrogen Co.) and probed by anti-human CYP11B1 (1:200, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), CYP11ß2 (1:1000, Santa Cruz Biotechnology, Inc) antibodies and mouse monoclonal anti-body for human ß-actin, Anti-Human ACTB (1:500, Cosmo Bio Co., Ltd., Tokyo, Japan). Then, probed proteins were treated with Amersham ECL Anti-Mouse IgG Horseradish Peroxidase-Linked Species-Specific Whole Antibody (GE Healthcare UK Ltd., Buckinghamshire, England) and visualized by ECL Plus Western Blotting Detection System (GE Healthcare UK Ltd.).
Aldosterone secretion from H295R cells was assayed essentially as described (Lesouhaitier et al., 2001) but with slight modification. Briefly, cells were plated in 6-well plates at a density of 2×106 cells/well and incubated at 37 ℃ for 48 h. Thereafter, the cells were incubated at 37 ℃ in DMEM/F12 without FBS, transferrin, or insulin for 24 h. The amounts of aldosterone and cortisol in the supernatant were determined using commercially available enzyme immunoassay kits (Cayman Chemical Company, MI, USA; Oxford Biomedical Research, Inc., MI, USA, respec- tively) according to the manufacturer’s instructions. The data were normalized with respect to the protein content of H295R cells, which were measured with a BCA protein assay kit (Pierce Pharmacoceutical, Inc., Rockford, IL, USA).
Statistical analysis was done by analysis of variance followed by a post hoc test for between-group comparison (StatView 5.0, SAS Institute, Inc., Cary, NC, USA). The level of statistical significance was set as P≤0.05, and all data are presented as mean±S.D.
3. Results
CYP11B1, CYP1132, and the @1H subunit of T-type Ca2+ channel mRNAs were all expressed in H295R cells (data not shown). All Ca2+
channel blockers suppressed angiotensin II- and KCl-induced increase in the expression of CYP11B1 and CYP1132 at both the mRNA and protein levels, and the magnitude of suppression of CYP11B1 and CYP1132 mRNAs by azelnidipine and efonidipine was much greater than that by nifedipine (P<0.01 vs. nifedipine, Fig. 1A-E). In addition, angiotensin II- induced expression of the @1H subunit of T-type Ca2+ channel mRNA was decreased significantly by Ca2+ channel blockers (azelnidipine P<0.01 vs. control; efonidipine P<0.01 vs. control; nifedipine P<0.05 vs. control; Fig. 1F). H2O2 and azelnidipine significantly suppressed expression of CYP1132 mRNA in H295R adrenocortical cells at 3 h without angiotensin II or KCI (H2O2 P<0.05; azelnidipine alone P<0.01; H2O2+azenlnidipine P<0.05 vs. 0.1% DMSO alone), thereafter, the expression of CYP11ß2 mRNA was recovered to basal level up to 24 h (data not shown). In contrast, H2O2 and azelnidipine significantly suppressed CYP11ß1 mRNA at 24 h (P<0.01 vs. 0.1% DMSO alone) but H2O2 exerted no additional suppressive effect on CYP11B1 mRNA by azelnidipine (data not shown).
Aldosterone secretion from H295R cells was suppressed in a dose- dependent manner by all Ca2+ channel blockers and the effects of azelnidipine and efonidipine on the secretion of aldosterone from H295R cells were more potent than that of nifedipine (Fig. 2A). Cortisol secretion from H295R cells was suppressed by all Ca2+ channel blockers,
A
B
1.25-
1.25
CYP11B1 mRNA (Arbitrary Unit)
1.00-
CYP11B1 mRNA (Arbitrary Unit)
*
1.00-
0.75-
*
0.75-
*
*
0.50-
0.50-
0.25-
0.25-
*
*
0.00
0.00
A
Az
Ef
Ni
K
Az
Ef
Ni
C
D
1.25
1.25
CYP11B2 mRNA (Arbitrary Unit)
1.00-
CYP11B2 mRNA (Arbitrary Unit)
1.00-
*
0.75-
0.75-
0.50-
*
*
0.50-
0.25-
*
0.25-
0.00
A
Az
Ef
Ni
0.00
K
Az
Ef
Ni
E
Angiotensin II
KCI
V
Az Ef Ni
Az Ef Ni
CYP11B1
CYP11B2
ß-actin
F
T-type Ca2+ channel
« 1H subunit mRNA (Arbitrary Unit)
1.25
1.00-
**
*
0.75-
*
0.50-
0.25-
0.00
A
Az
Ef
Ni
A
Release of aldosterone (pmol/mg protein)
40
30
**
**
20-
**
A
*
*
$
10-
*
*
$
0
A/V
U
-12
-10
-8
-6
Log (CCB [mol/[])
B
Release of cortisol (pmol/mg protein)
10000
8000-
*
*
6000-
*
4000-
2000-
0
A
Az
Ef
Ni
but the differences between Ca2+ blockers was not statistically significant (Fig. 2B).
4. Discussion
The present data showed that all three Ca2+ channel blockers (azelnidipine, efonidipine, and nifedipine) tested in this study sup- pressed the expression of the mRNA of steroid synthetases, such as CYP11B1 and CYP1132 in H295R cells, and nifedipine was the least potent. Ca2+ influx into H295R cells is involved in regulation of the expression of mRNAs for CYP11B1 and CYP1132, especially CYP11B2, and expression of the mRNAs of these enzymes was suppressed by Ca2+ channel blockers, indicating that L-type Ca2+ channels may be involved in steroid biosynthesis in adrenocortical cells (Bird et al., 1998; Clyne et al., 1996; Denner et al., 1996). Recently, it was reported that efonidpine and benidipine, which are dual (T-type/L-type) Ca2+ channel blockers, inhibited aldosterone biosynthesis in H295R cells more potently than the L-type Ca2+ channel blocker nifedipine via the dual blockade of T- type and L-type Ca2+ channels (Akizuki et al., 2008; Imagawa et al., 2006). In this study, we demonstrated that azelnidipine, an L-type Ca2+ channel blocker, exerts potent inhibitory effects on steroid biosynthesis in H295R cells with a potency equal to that of efonidipine. In addition, the earlier studies suggested the possible involvement of T-type Ca2+ channel activity on aldosterone biosynthesis in bovine adrenal glomerulosa cells (Rossier et al., 1998), and the possible action of azelnidipine on N-type and T-type Ca2+ channels in PC12 cells (Koike et al., 2002). Taken together, the present results for expression of the T- type Ca2+ channel, although inhibition of the &1H subunit of the T-type Ca2+ channel is the result of a reduction in channel open probability that is not accompanied by a change in channel expression or an alteration in active-channel gating (DePuy et al., 2006), suggests that azelnidipine may suppress aldosterone biosynthesis, at least in part, by modulation of T-type Ca2+ channel activity. Together with the results using H2O2, azelnidipine may suppress aldosterone-induced oxidative stress (Mar- ney and Brown, 2007) rather than oxidative stress-induced steroid biosynthesis.
The results of the present study indicate that azelnidipine may be useful in the therapeutic approach to steroid-induced hyperten- sion, i.e., primary aldosteronism, due to the combined properties of the suppressive effect on aldosterone biosynthesis and the re- ported anti-oxidative property against aldosterone-induced oxida- tive stress.
In conclusion, the present study showed that azelnidipine, a dihydropyridine Ca2+ channel blocker, has a potent inhibitory effect on both mRNA expression of steroid synthetases and the production of aldosterone and cortisol in H295R cells. Although the detailed mechanism underlying the inhibitory effects of azelnidipine remains to be clarified, azelnidipine may be a promising anti-hypertensive drug for the treatment of aldosterone-involved cardiovascular and renal diseases.
Acknowledgments
We are grateful to Daiichi-Sankyo Co. Ltd. for providing azelnidi- pine and Shionogi & Co., Ltd. for providing efonidipine, but these companies were not involved in the study design, experiments, data analysis, or interpretation of the data obtained in this study.
References
Akizuki, O., Inayoshi, A., Kitayama, T., Yao, K., Shirakura, S., Sasaki, K., Kusaka, H., Matsubara, M., 2008. Blockade of T-type voltage-dependent Ca2+ channels by benidipine, a dihydropyridine calcium channel blocker, inhibits aldosterone production in human adrenocortical cell line NCI-H295R. Eur. J. Pharmacol. 584, 424-434.
Bird, I.M., Mason, J.I., Rainey, W.E., 1998. Battle of the kinases: integration of adrenal responses to cAMP, DG and Ca2+ at the level of steroidogenic cytochromes P450 and 3BHSD expression in H295R cells. Endocr. Res. 24, 345-354.
Clyne, C.D., White, P.C., Rainey, W.E., 1996. Calcium regulates human CYP11B2 transcription. Endocr. Res. 22, 485-492.
Denner, K., Rainey, W.E., Pezzi, V., Bird, I.M., Bernhardt, R., Mathis, J.M., 1996. Differential regulation of 11B-hydroxylase and aldosterone synthase in human adrenocortical H295R cells. Mol. Cell. Endocrinol. 121, 87-91.
DePuy, S.D., Yao, J., Hu, C., McIntire, W., Bidaud, I., Lory, P., Rastinejad, F., Gonzalez, C., Garrison, J.C., Barrett, P.Q., 2006. The molecular basis for T-type Ca2+ channel inhibition by G protein B2y2 subunits. Proc. Natl. Acad. Sci. U. S. A. 103, 14590-14595.
Fiebeler, A., Muller, D.N., Shagdarsuren, E., Luft, F.C., 2007. Aldosterone, mineralocorticoid receptors, and vascular inflammation. Curr. Opin. Nephrol. Hypertens. 16, 134-142. George, J., Struthers, A.D., 2007. Evaluation of the aldosterone-blocking agent eplerenone in hypertension and heart failure. Expert. Opin. Pharmacother. 8, 3053-3059.
Imagawa, K., Okayama, S., Takaoka, M., Kawata, H., Naya, N., Nakajima, T., Horii, M., Uemura, S., Saito, Y., 2006. Inhibitory effect of efonidipine on aldosterone synthesis and secretion in human adrenocarcinoma (H295R) cells. J. Cardiovasc. Pharmacol. 47, 133-138.
Koike, H., Kimura, T., Kawasaki, T., Sada, T., Ikeda, T., Sanbuissho, A., Saito, H., 2002. Azelnidipine, a long-acting calcium channel blocker with slow onset and high vascular affinity. Annu. Rep. Sankyo. Res. Lab. 54, 1-64.
Lesouhaitier, O., Chiappe, A., Rossier, M.F., 2001. Aldosterone increases T-type calcium currents in human adrenocarcinoma (H295R) cells by inducing channel expression. Endocrinology 142, 4320-4330.
Li, J.M., Iwai, M., Cui, T.X., Min, L.J., Tsuda, M., Iwanami, J., Suzuki, J., Mogi, M., Horiuchi, M., 2005. Effect of azelnidipine on angiotensin II-mediated growth-promoting signaling in vascular smooth muscle cells. Mol. Pharmacol. 67, 1666-1673.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Marney, A.M., Brown, N.J., 2007. Aldosterone and end-organ damage. Clin. Sci. (Lond). 113, 267-278.
Matsui, T., Yamagishi, S., Nakamura, K., Kikuchi, S., Inoue, H., 2005. Azelnidipine, a dihydropyridine-based calcium antagonist, inhibits angiotensin II-induced oxida- tive stress generation and downregulation of pigment epithelium-derived factor mRNA levels in microvascular endothelial cells. Drugs Exp. Clin. Res. 31, 215-219.
Nakamura, T., Saito, Y., Saito, T., Kurabayashi, M., 2006. Azelnidipine down-regulates renal angiotensin-converting enzyme and mineralocorticoid receptor mRNA in diabetic hypertensive rats. J. Pharmacol. Sci. 102, 239-242.
Oizumi, K., Nishino, H., Miyamoto, M., Fukushige, J., Fukami, M., Koike, H., 1989. Beneficial renal effects of CS-905, a novel dihydropyridine calcium blocker, in SHR. Jpn. J. Pharmacol. 51, 501-508.
Okayama, S., Imagawa, K., Naya, N., Iwama, H., Somekawa, S., Kawata, H., Horii, M., Nakajima, T., Uemura, S., Saito, Y., 2006. Blocking T-type Ca2+ channels with efonidipine decreased plasma aldosterone concentration in healthy volunteers. Hypertens. Res. 29, 493-497.
Rader, D.J., Daugherty, A., 2008. Translating molecular discoveries into new therapies for atherosclerosis. Nature 451, 904-913.
Rossier, M.F., Ertel, E.A., Vallotton, M.B., Capponi, A.M., 1998. Inhibitory action of mibefradil on calcium signaling and aldosterone synthesis in bovine adrenal glomerulosa cells. J. Pharmacol. Exp. Ther. 287, 824-831.
Saito, T., Itoh, H., Chun, T.H., Fukunaga, Y., Yamashita, J., Doi, K., Tanaka, T., Inoue, M., Masatsugu, K., Sawada, N., Sakaguchi, S., Arai, H., Mukoyama, M., Tojo, K., Hosoya, T., Nakao, K., 2001. Coordinate regulation of endothelin and adrenomedullin secretion by oxidative stress in endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 281, H1364-1371. Schirpenbach, C., Reincke, M., 2007. Primary aldosteronism: current knowledge and controversies in Conn’s syndrome. Nat. Clin. Pract. Endocrinol. Metab. 3, 220-227. Unger, T., Jakobsen, A., Heroys, J., Ralph, A., Rees, T., Shaw, M., 2008. Targeting cardiovascular protection: the concept of dual renin-angiotensin system control. Medscape. J. Med. 10 (Suppl, S4).
Wellington, K., Scott, L.J., 2003. Azelnidipine. Drugs 63, 2613-2621; discussion 2623-2614. Yagil, Y., Miyamoto, M., Frasier, L., Oizumi, K., Koike, H., 1994. Effects of CS-905, a novel dihydropyridine calcium channel blocker, on arterial pressure, renal excretory function, and inner medullary blood flow in the rat. Am. J. Hypertens. 7, 637-646.