Differential Expression of Ghrelin and its Receptor (GHS-R1a) in Various Adrenal Tumors and Normal Adrenal Gland
| Authors | B. Ueberberg1, N. Unger1, S. Y. Sheu2, M. K. Walz3, K. W. Schmid2, W. Saeger4, K. Mann1, S. Petersenn1 |
| Affiliations | 1 Division of Endocrinology, Medical Center, University of Duisburg-Essen, Essen, Germany 2 Institute of Pathology, University of Duisburg-Essen, Essen, Germany 3 Department of Surgery and Center of Minimally Invasive Surgery, Kliniken Essen-Mitte, Essen, Germany 4 Institute of Pathology, Marienhospital, Hamburg, Germany |
Key words
· ghrelin GHS-R1a · adrenal gland
· tumor
expression
Abstract
&
Ghrelin is a newly characterized, widely dis- tributed peptide thought to be involved in the regulation of appetite. Significant effects on the release of growth hormone (GH) and ACTH have been demonstrated. This study compares the expression of ghrelin and its receptor (GHS-R) in various adrenal tumors and normal adrenal gland. Normal adrenal tissue was obtained after autopsy. Tissue was obtained from 13 pheo- chromocytomas (PHEOs), 15 cortisol-secreting adenomas (CPAs), 12 aldosterone-secreting ade- nomas (APAs), and 16 nonfunctional adenomas (NFAs) following laparoscopic surgery. Expres- sion of ghrelin and GHS-R1a was investigated on RNA levels by using real-time reverse transcrip- tion polymerase chain reaction (RT-PCR) and on protein levels by using immunohistochemistry. In the seven normal adrenal glands analyzed,
ghrelin mRNA levels were 12-fold lower than in stomach. Ghrelin protein expression was con- firmed by immunohistochemistry. In all adrenal tumors, relevant levels of ghrelin mRNA were observed, with significantly lower expression in PHEOs and APAs than in normal adrenal gland. Ghrelin protein was detected in 0% of PHEOs, 55 % of APAs, 87% of CPAs, and 54% of NFAs. GHS-R1a mRNA expression was detectable in normal adre- nal gland, but the receptor protein was absent. In adrenal tumors, detectable levels of receptor mRNA were found in 38% of PHEOs, 13% of CPAs, and 25% of NFAs. GHS-R1a protein was absent in the majority of adrenal tumors. Expression of ghrelin in normal adrenal gland and adrenal tumors may indicate some unknown physiologi- cal function. The pathophysiological relevance of ghrelin expression in adrenal tumors remains to be investigated.
received 19.03.2007 accepted 10.07.2007
Bibliography DOI 10.1055/s-2007-1004574 Published online: February 4, 2008 Horm Metab Res 2008; 40: 181-188 @ Georg Thieme Verlag KG Stuttgart . New York ISSN 0018-5043
Correspondence
PD Dr. med. S. Petersenn Division of Endocrinology Medical Center University of Duisburg-Essen Hufelandstr. 55 45122 Essen Germany Tel .: +49/201/723 28 54
Fax: +49/201/723 59 76 stephan.petersenn@uni-due.de
Introduction
&
Ghrelin is a newly characterized, 28-amino-acid peptide that was originally isolated from rat stomach [1]. Later studies demonstrated the expression of ghrelin and its receptor in human stomach, pituitary, and hypothalamus, as well as in several other peripheral tissues [2,3]. Ghrelin demonstrates potent and reproducible growth hormone (GH)-releasing activity. Apart from this effect, it also significantly stimulates the release of prolactin, adrenocorticotropic hormone (ACTH), cortisol, and aldosterone [4-6]. However, its major physiological relevance may relate to energy homeostasis. Ghrelin is thought to be involved in the regulation of appetite, carbohy- drate metabolism, heart function, gonadal axis, exocrine function, and cell proliferation [7-13]. Ghrelin binds to a specific receptor, GHS-R. Two subtypes of GHS-R, complementary DNAs 1a and
1b, have been identified in human, pig, and rat. They differ in their 3’-terminal amino acids gen- erated by alternative splicing and show no sig- nificant homology with other receptors known so far. In humans, only the GHS-R type 1a con- sisting of 366 amino acids is fully functional, whereas GHS-R type 1b is considered to be bio- logically inactive [3, 14, 15]. The main expression of GHS-R1a mRNA has been described in pitui- tary, hypothalamus, and hippocampus [16].
We investigated expression of ghrelin and its receptor GHS-R 1a in a wide range of human tis- sues. Surprisingly, ghrelin mRNA levels detected in normal human adrenal gland were higher than in most other tissues investigated, although lower than in the stomach analyzed (data not shown). In previous studies, human adrenal gland was found to express the mRNA of ghrelin and its receptor GHS-R1a [2, 17, 18]. Nonetheless, there is only a small amount of data available
| No. | Age | Sex | Etiology | Size (cm) |
|---|---|---|---|---|
| P1 | 46 | w | PHEO | 2 |
| P2 | 32 | w | PHEO | 2 |
| P3 | 35 | w | PHEO | 4 |
| P4 | 24 | w | PHEO | 3 |
| P5 | 42 | w | PHEO | 3 |
| P6 | 58 | m | PHEO | 3.5 |
| P7 | 17 | m | PHEO | 3.5 |
| P8 | 52 | w | PHEO | 2.5 |
| P9 | 57 | m | PHEO | 6 |
| P10 | 15 | m | PHEO | 3 |
| P11 | 44 | m | PHEO | 3 |
| P12 | 55 | w | PHEO | 2.5 |
| P13 | 39 | m | PHEO | 1.5 |
| C1 | 49 | w | CPA | 4.8 |
| C2 | 59 | w | CPA | n.v. |
| C3 | 30 | w | CPA | 1.8 |
| C4 | 56 | w | CPA | 3.2 |
| C5 | 54 | w | CPA | 4 |
| C6 | 31 | w | CPA | 2 |
| C7 | 31 | w | CPA | 2 |
| C8 | 69 | w | CPA | 4 |
| C9 | 33 | w | CPA | 3 |
| C10 | 39 | w | CPA | 3.7 |
| C11 | 36 | w | CPA | 5 |
| C12 | 77 | w | CPA | 2.5 |
| C13 | 56 | w | CPA | 3.2 |
| C14 | 40 | w | CPA | 3 |
| C15 | 41 | w | CPA | 2 |
| A1 | 46 | m | APA | 2.5 |
| A2 | 33 | w | APA | 3 |
| A3 | 49 | w | APA | 2.5 |
| A4 | 19 | w | APA | 3 |
| A5 | 56 | m | APA | 3 |
| A6 | 36 | w | APA | 2.5 |
| A7 | 64 | w | APA | 3 |
| A8 | 45 | m | APA | 1.5 |
| A9 | 28 | w | APA | 1.5 |
| A10 | 43 | w | APA | 2.5 |
| A11 | 60 | w | APA | 0.7 |
| A12 | 40 | m | APA | 1.8 |
| N1 | 29 | m | NFA | 2 |
| N2 | 66 | w | NFA | 1 |
| N3 | 31 | w | NFA | 2.5 |
| N4 | 35 | w | NFA | 6.5 |
| N5 | 66 | w | NFA | 6 |
| N6 | 57 | m | NFA | 3.5 |
| N7 | 35 | m | NFA | 2.5 |
| N8 | 48 | m | NFA | 2 |
| N9 | 62 | w | NFA | 2.5 |
| N10 | 31 | m | NFA | 0.6 |
| N11 | 64 | m | NFA | 6 |
| N12 | 66 | m | NFA | 7 |
| N13 | 68 | w | NFA | 3 |
| N14 | 68 | w | NFA | 2.2 |
| N15 | 40 | m | NFA | 3.5 |
| N16 | 51 | m | NFA | 2 |
| AG1 | 66 | w | normal | |
| AG2 | 51 | m | normal | |
| AG3 | 43 | m | normal | |
| AG4 | 39 | m | normal | |
| AG5 | 69 | w | normal | |
| AG6 | 68 | m | normal | |
| AG7 | 65 | m | normal |
regarding the role of ghrelin and GHS-R1a in the regulation of adrenocortical functions in human.
Benign adrenal tumors are among the most common tumors in humans [19], but their pathogenesis is largely unknown. Because of the influence of ghrelin on cell secretion and proliferation, we investigated expression of ghrelin and its receptor GHS-R 1a in normal adrenal gland and various adrenal tumors.
Methods
&
Tissue and RNA samples
Tissue was obtained from 13 adrenal pheochromocytomas (PHEOs), 15 cortisol-secreting adenomas (CPAs), 12 aldosterone- secreting adenomas (APAs), and 16 nonfunctional adenomas (NFAs) following retroperitoneoscopic surgery. Seven normal adrenal glands were obtained during autopsy (postmortem delay ~3h) (Table 1). Fragments of whole adrenal glands, includ- ing medulla and cortex, were used for RNA extraction. For RNA analysis, fragments were snap-frozen in liquid nitrogen and stored at - 80℃. Furthermore, fragments were paraffin-embed- ded for later immunohistochemical analysis. Histological inves- tigation confirmed the presence of an adenoma in all cases as well as the diagnosis of pheochromocytomas. Functional classi- fication of the adrenal adenomas was established by clinical and hormonal data. Pheochromocytomas were characterized by enhanced levels of urinary catecholamines or metanephrines, whereas cortisol-secreting adenomas were characterized by elevated cortisol levels in 24-hour urine and by lack of cortisol suppression in a dexamethasone suppression test. Aldosterone- secreting adenomas were established by an increased aldoste- rone:renin ratio. Tumors were localized with magnetic resonance imaging. Regarding pheochromocytomas, mutations in the ret oncogene were excluded in all tumors. In the family history of patients with pheochromocytomas, there was no evidence for hereditary bases.
RNA extraction
Total RNA was extracted with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. RNA samples were incubated at 25 ℃ for 30 minutes with RNase-free DNase (Roche Applied Science) (1 U/1 µg RNA) to degrade possible contaminat- ing genomic DNA, followed by heating at 75 ℃ for 5 minutes to inactivate the enzyme. Aliquots of the RNA samples were elec- trophoresed to confirm the intactness of the RNA.
Reverse transcription polymerase chain reaction (RT- PCR) and cloning of specific gene sequences for ghrelin and GHS-R1a
Total RNA (500ng) was reverse transcribed and amplified by polymerase chain reaction (PCR) by using a Gene Amp RNA PCR Kit (Applied Biosystems) according to the manufacturer’s proto- col, with the primers presented in Table 2. The PCR conditions were as follows: 1 minute at 95°℃, 1 minute at 55℃, and 1 minute at 72℃ for 40 cycles. The PCR products were fraction- ated by electrophoresis and detected with ethidium bromide. The integrity of RNA and the absence of genomic DNA contami- nation were confirmed by RT-PCR/PCR amplification of the con- trol gene beta-2-microglobulin (B-2-MG).
The PCR products of ghrelin and GHS-R1a were extracted from the agarose gel by using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s protocol and cloned into the
| Primer | 5' ... 3' | Primer localization | Annealing T | Product length | Accession no. |
|---|---|---|---|---|---|
| Ghrelin | AGCAGGCTGGCTCCGC | 192 | 60℃ | 68 bp | AB029434 |
| ACCGGACTTCCAGTTCATCCT | 259 | ||||
| GHSR-1a | CTGTCGTGGGTGCCTCG | 740 | 60℃ | 67 bp | U60179 |
| ACCACTACAGCCAGCATTTTCA | 806 | ||||
| ß-2-MG | ACCCCCACTGAAAAAGATGA | 331 | 55℃ | 113 bp | NM004048 |
| ATCTTCAAACCTCCATGATG | 444 | ||||
| Probe | |||||
| Ghrelin | CGGAAGATGGAGGTCAAGCAGAAGGG | 209 | 60℃ | AB029434 | |
| GHSR-1a | TCAGGGACCAGAACCACAAGCAAACC | 758 | 60℃ | U60179 |
pCR2.1 vector with the TA Cloning Kit (Invitrogen). The sequences of the inserted fragments were confirmed by sequencing.
Quantitative real-time RT-PCR
RT-PCR primers and probes for the human ghrelin and GHS-R type 1a were designed by using the Primer Express software (PE Applied Biosystems, Warrington, UK) and based on the sequence data of the genes available in GeneBank (Table 2). In each case, the primers were designed to cross exon-intron boundaries. The probes for ghrelin and GHS-R1a were labeled with fluorescent dye (6-carboxyfluorescein) and a quencher dye (6-carboxytetra- methylrhodamine). Amplification of human glyceraldehyde-3- phosphate dehydrogenase (GAPDH) was used as a standard for the quality of the RNA samples investigated. Samples negative for GAPDH were excluded from quantification. The GAPDH probe was labeled with VIC (Applied Biosystems) as fluorescent dye, so that both amplifications (ghrelin or GHS-R1a and GAPDH) could be carried out in the same reaction.
We used the One-Step RT-PCR Master Mix Reagents Kit from Applied Biosystems according to the manufacturer’s protocol with 100 nM of the ghrelin or GHS-R1a probe. The highest ampli- fication efficiency was reached for ghrelin with 300nM of each primer and for GHS-R1a with 900 nM of each primer. All clinical samples were tested in triplicate. One no-template control was included in every amplification run. The RT-PCR reactions were performed, recorded, and analyzed with the ABI7300 Real Time PCR System (Applied Biosystems).
Ghrelin and GHS-R1a mRNA levels were normalized to GAPDH mRNA levels obtained in the same reaction. In multiple studies investigating mRNA expression in adrenal tissue, GAPDH was used as a standard control [2,18,20]. In primary cell culture studies, we did not find any regulation of GAPDH by hormones such as ACTH and angiotensin II. However, we cannot exclude regulation of GAPDH by unknown factors. In order to define the mRNA copy number/µg total RNA, we carried out serial dilutions using plas- mids with inserted RT-PCR products of ghrelin and GHS-R1 a mRNA. The standard curves were obtained by plotting the log (calculated copy number) against the threshold cycle. The detection limit of 0.1 copies of ghrelin mRNA molecules/µg total RNA and 4.6 copies of GHS-R1a mRNA molecules/µg total RNA was calculated using the upper limit of cycles. Tissues with mRNA levels lower than the detection limit were defined as negative for ghrelin or GHS-R1a mRNA expression. Stomach total RNA and total RNA obtained from a GH-secreting pituitary adenoma were used as positive controls for the amplification of ghrelin and GHS-R1a, respectively.
Statistical evaluation was performed by using the Kruskal-Wallis test followed by Dunn’s comparison test.
Immunohistochemistry
Immunohistochemistry was performed on neutral-buffered, formaldehyde-fixed, paraffin-embedded tissues. The Alkaline Phosphatase/RED ChemMate Detection Kit (DakoCytomation) was used for ghrelin staining. The LSAB+System-AP Detection Kit (DakoCytomation) was used for GHS-R1a peptide detection. Immunohistochemical stainings were performed according to the manufacturer’s protocols. A rabbit anti-ghrelin polyclonal antibody (Phoenix Pharmaceuticals, 1:4000) and a goat polyclo- nal antibody against the C-terminus of GHS-R1a (Santa Cruz, 1:250) were the primary antibodies. Dilution of the primary antibodies was performed in antibody diluent from DakoCyto- mation. Tissue sections were counterstained with hematoxylin. The control experiments included staining without the primary antibody and neutralization of the primary antibody binding by preabsorption with the specific blocking peptide. Notably, the neutralization of GHS-R1a antibody binding using the specific blocking peptide from Santa Cruz led to a strong background staining, so that the expected neutralization was not recogniza- ble. Gastric antrum sections were used as the positive control for ghrelin staining, and sections of a GH-secreting adenoma were used as the positive control for GHS-R1a staining.
Results
&
Ghrelin mRNA and peptide expression in normal and tumorous adrenal tissue
In normal adrenal tissue obtained during the autopsy of seven subjects, the ghrelin mRNA expression levels ranged from 3.3×103 to 1.8×104 copies of ghrelin mRNA molecules/µg total RNA, with a median of 6.3×103 copies/µg RNA (cp) (· Fig. 1). Ghrelin mRNA levels observed in normal adrenal gland were 13- fold lower than in stomach.
Regarding the various adrenal tumors analyzed, all tumors (13 PHEOs, 15 CPAs, 12 APAs, 16 NFAs) demonstrated expression of ghrelin mRNA ( Fig. 1). The expression levels ranged from comparable levels to one-thirtieth of the levels observed in nor- mal adrenal gland (from 2.5 x 102 to 1.4x 104 cp). The mRNA lev- els ranged from 4.7×102 to 5.2×103cp with a median of 2.1 × 103 cp in PHEO; from 2.6× 102 to 1.1 × 104 cp with a median of 2.1 × 103 cp in CPA; from 2.7 × 102 to 6.8 x 103 cp with a median of 1.7×103 cp in APA; and from 3.1×102 to 1.4x104cp with a median of 2.3 × 103 cp total RNA in NFA.
In the normal adrenal gland, the ghrelin peptide was detected only in the zona reticularis of the adrenal cortex ( Fig. 2). The other layers of the adrenal cortex and the adrenal medulla were negative for ghrelin staining. In adrenal tumors, ghrelin peptide expression was detected in 0% of PHEOs, in 87% of CPAs, in 55%
of APAs, and in 54% of NFAs (· Fig. 3; Table 3). Regarding posi- tively stained CPAs, in 7% of these tumors more than 60% of tumor cells were positive. In 47% of the tumors, 30-60% were positively stained, and in 33%, less than 30% of tumor cells were positively stained. All positively stained APAs revealed a positive staining in less than 30% of the tumor cells. In positively stained NFAs, in 31% of these tumors 30-60% of tumor cells were posi- tive, and in 23% less than 30% were positive. No significant cor- relation between mRNA expression levels and peptide expression was detectable.
GHS-R1a mRNA and peptide expression in normal and tumorous adrenal tissue
The levels of GHS-R1a mRNA in normal adrenal tissue obtained during autopsy of seven subjects ranged from 4.4x 10 to 1 x 104
106
p < 0.05
ns
p < 0.05
105
ns
Ghrelin copies/ug RNA
104
103
102
101
10°
PHEO
CPA
APA
NFA
Adre
copies of GHS-R1a mRNA molecules/µg total RNA, with a median of 3.5 × 103 cp (· Fig. 4). A GH-secreting pituitary adenoma used as a positive control demonstrated expression levels 311 times higher than normal adrenal gland.
Regarding the adrenal tumors analyzed, relevant levels of recep- tor mRNA were demonstrated in only 20% of the various adrenal tumors (· Fig. 4). GHS-R1a expression was detectable in 38% of all PHEOs investigated, ranging from 5.8× 10 to 1.8x 103 cp with a median of 3.2× 102 cp. Thirteen percent of CPAs were positive for GHS-R1a expression, with levels ranging from 1.2×102 to 3.1 × 102 cp with a median of 2.1 × 102 cp. In NFAs, GHS-R 1 a mRNA was demonstrated in 25% of these tumors, with levels ranging from 1.3×10 to 1.7× 102cp and a median of 5.5x10 cp. Because the mRNA levels were below the detection limit, all APAs ana- lyzed were defined as negative for GHS-R1a mRNA expression. In contrast to the results of the RNA analysis, GHS-R1a peptide was absent in the normal adrenal gland ( Fig. 2). The GHS- R1a protein was detectable in 50% of mRNA-positive PHEOs ( Fig. 5; Table 3). GHS-R1a was absent in all PHEOs with mRNA levels below the detection limit, thus confirming the results of the mRNA analysis. In CPAs, in 8%>60%, in 17% 30-60%, and in 17% <30% of tumor cells were positively stained. Fifty percent of the tumors with detectable mRNA expression were positive for GHS-R1a staining. Furthermore, the GHS-R1a was absent in 60% of GHS-R1a mRNA-negative CPAs. Corresponding to the absence of GHS-R1a in APAs, 91 % of these tumors were negative for GHS- R1a staining. In NFAs, all tumors with detectable GHS-R1 a mRNA levels were negative for the peptide staining. The GHS-R1a pep- tide was absent in 89% of the NFAs with GHS-R1a mRNA levels below the detection limit.
Discussion
&
Multiple studies have analyzed ghrelin expression in various human tissues. In this study, we demonstrated that ghrelin mRNA is expressed in normal human adrenal gland. In compari-
Zg
-
-
Zf
-
-
+
-
M
7
-
A
B
+
+
C
D
-
+
| Ghrelin | GHS-R1a | |||
|---|---|---|---|---|
| mRNA | Peptide | mRNA | Peptide | |
| PHEO | 100% | 0% | 25% | 50% |
| CPA | 100% | 87% | 17% | 50% |
| APA | 100% | 55% | 0% | 0% |
| NFA | 100% | 54% | 25% | 0% |
son to Gnanapavan et al. [2], the ghrelin mRNA levels in our study were ~102 times higher than the levels they detected in normal adrenal gland. An explanation for this difference might be the different RNA sources. Gnanapavan et al. extracted RNA from adrenal gland tissue obtained during surgery of a single patient, whereas we used normal adrenal glands obtained dur- ing autopsy. Furthermore, Carraro et al. [21] demonstrated a highly significant negative correlation between ghrelin mRNA expression and the age of the patients, which also may contrib- ute to the observed differences. Other studies also have described the expression of ghrelin in the adrenal gland by various methods. Tortella et al. [18] detected ghrelin mRNA expression and ghrelin-binding sites in the human adrenal cor- tex by autoradiography with [ 125 I]ghrelin. Andreis et al. [20] demonstrated mRNA expression of ghrelin and its receptor in rat adrenal cortex. Abundant ghrelin-binding sites were local- ized in the adrenal zona glomerulosa and zona fasciculata. Our immunohistochemical analysis confirmed the results of the mRNA analysis demonstrating ghrelin peptide expression in the inner zone of the human adrenal cortex, the zona reticularis. Takaya et al. [6] observed increased ACTH and cortisol levels after ghrelin injection. In rats, it was found that ghrelin did not affect the secretory activity of adrenocortical cells but signifi- cantly enhanced the proliferation rate of cultured zona glomer- ulosa cells, without affecting apoptotic deletion rate [20]. These
106
ns
p < 0.00
105
1
p < 0.01
p < 0.001
GHS-R copies/µg RNA
104
103
.
102
A
.
101
10°
PHEO
CPA
APA
NFA
Adre
findings suggest that ghrelin is involved in the autocrine/ paracrine regulation of adrenocortical functions and adrenal growth. In contrast to the observation that ghrelin promotes cortisol and aldosterone secretion, we found ghrelin not only in CPAs and APAs but also in NFAs. Moreover, ghrelin levels in APAs were the lowest in comparison to other adrenocortical tumors. This finding may bring into question the physiological role of ghrelin in the stimulation of aldosterone secretion. The expres- sion of ghrelin in normal human adrenal gland possibly points to an involvement of the adrenal gland in the regulation of appetite mediated by ghrelin. In previous studies, an interaction between glucocorticoids, GHS, and appetite was proposed [22-24]. Tung et al. [24] observed a stimulating effect of GHS on food intake in adrenal-intact and adrenalectomized rats with corticosterone replacement but not in adrenalectomized rats.
Downloaded by: University of Georgia Libraries. Copyrighted material.
A
B
Fig. 5 Immunohistochemical detection of GHS- R1a in adrenal tumors. Sections were stained with a polyclonal antibody against GHS-R1a and counterstained with hematoxylin. Slides (400x) demonstrate representative stains of each tumor entity. Panel A: aldosterone-producing adenoma. Panel B: cortisol-producing adenoma. Panel C: pheochromocytoma. Panel D: nonfunctional adenoma. + = protein expression; - = no detectable expression.
-
+
C
D
0
-
-
Expression of ghrelin mRNA was detectable in all adrenal tumors analyzed, but expression levels in pheochromocytomas and aldosterone-secreting adenomas were significantly lower than the levels demonstrated in normal adrenal glands. Barzon et al. [25] demonstrated ghrelin mRNA expression in adrenocortical adenomas by using a similar technique. The detected mRNA lev- els were comparable to the mRNA amounts in our study. Similar to our results, they observed the lowest levels of ghrelin mRNA expression in aldosterone-secreting adenomas in comparison to other adrenocortical tumors, but they did not study differences at the protein level.
In contrast to the precise quantification available with real-time RT-PCR, quantification of immunohistochemical results is rather rough. We performed a correlation analysis between mRNA expression levels and positively stained tumor cells, which showed no significant correlations in most adrenal diseases investigated, with low mRNA already leading to positive immu- nohistochemical staining and vice versa. Translation into protein may underlie specific regulation independent of transcriptional control, pointing to the necessity of investigating protein levels. Corresponding to the observation that the adrenal medulla did not contain the ghrelin peptide, we did not detect the ghrelin peptide in pheochromocytomas. Cortisol-secreting and aldo- sterone-secreting adenomas were formed in ghrelin-negative zones of the normal adrenal gland. It is unclear what relevance ghrelin expression in these adenomas might have for tumor pathogenesis. To our knowledge, there are no previous data available regarding the expression of ghrelin peptide in adreno- cortical adenomas or the expression of ghrelin mRNA and pep- tide in pheochromocytomas.
Ghrelin acts as a specific endogenous ligand for GHS-R type 1a. In studies of GHS-R1a knockout mice [26], it has been demon- strated that GHS-R is the relevant receptor for the ghrelin-medi- ated stimulatory effects on GH secretion and food intake. The expression of this receptor has been analyzed in multiple stud- ies using RT-PCR [8, 18,27,28]. In our study, we demonstrated significant expression levels of GHS-R1a mRNA in normal adre- nal gland RNA. The levels detected were lower than the mRNA
levels expressed in pituitary but much higher than those observed in the other human tissues investigated (data not shown). Gnanapavan et al. [2] detected levels of GHS-R1a mRNA in human adrenal gland comparable to the levels we observed in normal adrenal gland. Carraro et al. [29] and Tortorella et al. [18] also found sizeable expression of GHS-R1a mRNA in the human adrenal cortex by using RT-PCR. Corresponding to these find- ings, Tortorella et al. [18] demonstrated abundant [ 125 I]ghrelin- binding sites in the human adrenal cortex, which were mainly located in the zona glomerulosa and the outer part of the zona fasciculata. In another study, Papotti et al. [30] investigated the presence of GHS receptors in several peripheral human tissues by radioreceptor assay and found binding sites for ghrelin in the adrenal gland. Andreis et al. [20] demonstrated significant GHS- R mRNA expression in the rat adrenal cortex by using RT-PCR. Furthermore, these investigators detected abundant [ 125 I]ghrelin- binding sites in the outer portion of the adrenal cortex and to a lesser extent in the adrenal medulla by autoradiography. In con- trast, we could not detect GHS-R1a peptide expression in the normal adrenal gland, possibly pointing to the presence of receptor variants with ghrelin-binding activity or to a limited sensitivity of our immunohistochemistry. Tortorella et al. [18] demonstrated no significant effect of ghrelin on basal or ago- nist-stimulated steroid hormone synthesis. Therefore, the role of the ghrelin receptor for the regulation of adrenocortical func- tion is not clear.
Corresponding to our data, GHS-R1a was undetectable by real- time RT-PCR in the majority of adrenocortical adenomas investi- gated by Barzon et al. [25]. Furthermore, the levels of expressed GHS-R1a mRNA in those tumors were significantly lower than in the normal human adrenal cortex, as in our results. To the best of our knowledge, the expression of GHS-R1a in pheochromocy- tomas has not been previously studied.
Our observations at the mRNA level were confirmed by the immunohistochemical analysis. We detected relevant expres- sion of GHS-R1a mRNA and peptide in only a few of the various adrenal tumors analyzed. The absence of GHS-R1a peptide expression corresponded to the lack of GHS-R1a expression in
Downloaded by: University of Georgia Libraries. Copyrighted material.
the normal adrenal gland. An explanation for the undetectable expression of GHS-R1a in most cortisol-secreting adenomas may be derived from the findings of Kaji et al. [31] and Petersenn et al. [32]. In transfection experiments with rat pituitary tumor cells, Kaji et al. [31] demonstrated that glucocorticoid downreg- ulates ghrelin receptor gene expression. The inhibition of GHS-R promoter activity by hydrocortisone was also shown in transfec- tion experiments using GH4 rat pituitary cells by Petersenn et al. [32]. The possible pathophysiological relevance of GHS-R1a expression in a few of the adrenal tumors is unclear.
In conclusion, expression levels of ghrelin mRNA in the normal adrenal gland were comparable to the mRNA levels in various adrenal tumors. But in contrast to ghrelin peptide expression in cortisol-secreting and aldosterone-secreting adenomas, ghrelin expression in the normal adrenal gland is limited to the zona reticularis. Ghrelin expression may suggest some function as an intra-adrenal regulator. Alternatively, expression of ghrelin may point to some function in a new system of interaction between the hypothalamus-pituitary-adrenal axis and the regulation of appetite. In future studies, the effect of ghrelin on hormone secretion and cell proliferation in primary cell cultures of nor- mal human adrenal gland and various adrenal tumors has to be investigated to identify a possible pathophysiological relevance or therapeutic importance of ghrelin. Furthermore, future stud- ies should look into changes in appetite and metabolism in patients after adrenalectomy.
Acknowledgments
&
This work was supported by a grant from the Deutsche For- schungsgemeinschaft (Pe 509/5-1).
References
1 Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghre- lin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999; 402: 656-660
2 Gnanapavan S, Kola B, Bustin SA, Morris DG, Mcgee P, Fairclough P, Bhattacharya S, Carpenter R, Grossman AB, Korbonits M. The tissue distribution of the mRNA of ghrelin and subtypes of its receptor, GHS- R, in humans. J Clin Endocrinol Metab 2002; 87: 2988
3 Howard AD, Feighner SD, Cully DF, Arena JP, Liberator PA, Rosenblum CI, Hamelin M, Hreniuk DL, Palyha OC, Anderson J, Paress PS, Diaz C, Chou M, Liu KK, Mckee KK, Pong SS, Chaung LY, Elbrecht A, Dashkevicz M, Heavens R, Rigby M, Sirinathsinghji DJ, Dean DC, Melillo DG, Patchett AA, Nargund R, Griffin PR, Demartino JA, Gupta SK, Schaeffer JM, Smith RG, Ploeg LH Van Der. A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 1996; 273: 974-977
4 Arvat E, Maccario M, Vito L Di, Broglio F, Benso A, Gottero C, Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, Camanni F, Ghigo E. Endocrine activities of ghrelin, a natural growth hormone secreta- gogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. J Clin Endo- crinol Metab 2001; 86: 1169-1174
5 Cunha SR, Mayo KE. Ghrelin and growth hormone (GH) secretagogues potentiate GH-releasing hormone (GHRH)-induced cyclic adenosine 3’,5’-monophosphate production in cells expressing transfected GHRH and GH secretagogue receptors. Endocrinology 2002; 143: 4570-4582
6 Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, Hosoda K, Akamizu T, Kojima M, Kangawa K, Nakao K. Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 2000; 85: 4908-4911
7 Broglio F, Arvat E, Benso A, Gottero C, Muccioli G, Papotti M, Lely AJ Van Der, Deghenghi R, Ghigo E. Ghrelin, a natural GH secreta- gogue produced by the stomach, induces hyperglycemia and red-
uces insulin secretion in humans. J Clin Endocrinol Metab 2001; 86: 5083-5086
8 Date Y, Nakazato M, Hashiguchi S, Dezaki K, Mondal MS, Hosoda H, Kojima M, Kangawa K, Arima T, Matsuo H, Yada T, Matsukura S. Ghre- lin is present in pancreatic alpha-cells of humans and rats and stim- ulates insulin secretion. Diabetes 2002; 51: 124-129
9 Lee HM, Wang G, Englander EW, Kojima M, Greeley Jr GH. Ghrelin, a new gastrointestinal endocrine peptide that stimulates insulin secre- tion: enteric distribution, ontogeny, influence of endocrine, and die- tary manipulations. Endocrinology 2002; 143: 185-190
10 Murata M, Okimura Y, Iida K, Matsumoto M, Sowa H, Kaji H, Kojima M, Kangawa K, Chihara K. Ghrelin modulates the downstream molecules of insulin signaling in hepatoma cells. J Biol Chem 2002; 277: 5667- 5674
11 Nagaya N, Kojima M, Uematsu M, Yamagishi M, Hosoda H, Oya H, Hayashi Y, Kangawa K. Hemodynamic and hormonal effects of human ghrelin in healthy volunteers. Am J Physiol Regul Integr Comp Physiol 2001; 280: R1483-R1487
12 Tena-Sempere M, Barreiro ML, Gonzalez LC, Gaytan F, Zhang FP, Caminos JE, Pinilla L, Casanueva FF, Dieguez C, Aguilar E. Novel expres- sion and functional role of ghrelin in rat testis. Endocrinology 2002; 143: 717-725
13 Wren AM, Seal LJ, Cohen MA, Brynes AE, Frost GS, Murphy KG, Dhillo WS, Ghatei MA, Bloom SR. Ghrelin enhances appetite and increases food intake in humans. J Clin Endocrinol Metab 2001; 86: 5992
14 Mckee KK, Palyha OC, Feighner SD, Hreniuk DL, Tan CP, Phillips MS, Smith RG, Ploeg LH Van Der, Howard AD. Molecular analysis of rat pituitary and hypothalamic growth hormone secretagogue receptors. Mol Endocrinol 1997; 11: 415-423
15 Yokote R, Sato M, Matsubara S, Ohye H, Niimi M, Murao K, Takahara J. Molecular cloning and gene expression of growth hormone-releasing peptide receptor in rat tissues. Peptides 1998; 19: 15-20
16 Guan XM, Yu H, Palyha OC, Mckee KK, Feighner SD, Sirinathsinghji DJ, Smith RG, Ploeg LH Van Der, Howard AD. Distribution of mRNA encod- ing the growth hormone secretagogue receptor in brain and periph- eral tissues. Brain Res Mol Brain Res 1997; 48: 23-29
17 Papotti M, Cassoni P, Volante M, Deghenghi R, Muccioli G, Ghigo E. Ghrelin-producing endocrine tumors of the stomach and intestine. J Clin Endocrinol Metab 2001; 86: 5052-5059
18 Tortorella C, Macchi C, Spinazzi R, Malendowicz LK, Trejter M, Nussdorfer GG. Ghrelin, an endogenous ligand for the growth hormone-secretagogue receptor, is expressed in the human adrenal cortex. Int J Mol Med 2003; 12: 213-217
19 Mansmann G, Lau J, Balk E, Rothberg M, Miyachi Y, Bornstein SR. The clinically inapparent adrenal mass: update in diagnosis and manage- ment. Endocr Rev 2004; 25: 309-340
20 Andreis PG, Malendowicz LK, Trejter M, Neri G, Spinazzi R, Rossi G P, Nussdorfer GG. Ghrelin and growth hormone secretagogue receptor are expressed in the rat adrenal cortex: Evidence that ghrelin stimu- lates the growth, but not the secretory activity of adrenal cells. FEBS Lett 2003; 536: 173-179
21 Carraro G, Albertin G, Aragona F, Forneris M, Casale V, Spinazzi R, Nussdorfer GG. Age-dependent decrease in the ghrelin gene expres- sion in the human adrenal cortex: a real-time PCR study. Int J Mol Med 2006; 17: 319-321
22 Tschöp M, Flora DB, Mayer JP, Heiman ML. Hypophysectomy prevents ghrelin-induced adiposity and increases gastric ghrelin secretion in rats. Obes Res 2002; 10: 991-999
23 Proulx K, Vahl TP, Drazen DL, Woods SC, Seeley RJ. The effect of adrena- lectomy on ghrelin secretion and orexigenic action. J Neuroendocrinol 2005; 17: 445-451
24 Tung YL, Hewson AK, Dickson SL. Glucocorticoid-dependent stimula- tion of adiposity and appetite by a ghrelin mimetic in the rat. Eur J Endocrinol 2004; 150: 905-911
25 Barzon L, Pacenti M, Masi G, Stefani AL, Fincati K, Palu G. Loss of growth hormone secretagogue receptor 1a and overexpression of type 1b receptor transcripts in human adrenocortical tumors. Oncology 2005; 68: 414-421
26 Sun Y, Wang P, Zheng H, Smith RG. Ghrelin stimulation of growth hormone release and appetite is mediated through the growth hor- mone secretagogue receptor. Proc Natl Acad Sci USA 2004; 101: 4679-4684
27 Date Y, Kojima M, Hosoda H, Sawaguchi A, Mondal MS, Suganuma T, Matsukura S, Kangawa K, Nakazato M. Ghrelin, a novel growth hor- mone-releasing acylated peptide, is synthesized in a distinct endo- crine cell type in the gastrointestinal tracts of rats and humans. Endocrinology 2000; 141: 4255-4261
28 Gaytan F, Barreiro ML, Caminos JE, Chopin LK, Herington AC, Morales C, Pinilla L, Paniagua R, Nistal M, Casanueva FF, Aguilar E, Dieguez C, Tena-Sempere M. Expression of ghrelin and its functional receptor, the type 1a growth hormone secretagogue receptor, in nor- mal human testis and testicular tumors. J Clin Endocrinol Metab 2004; 89: 400-409
29 Carraro G, Albertin G, Abudukerimu A, Aragona F, Nussdorfer GG. Growth hormone secretagogue receptor subtypes 1a and 1b are expressed in the human adrenal cortex. Int J Mol Med 2004; 13: 295-298
30 Papotti M, Ghe C, Cassoni P, Catapano F, Deghenghi R, Ghigo E, Muc- cioli G. Growth hormone secretagogue binding sites in peripheral human tissues. J Clin Endocrinol Metab 2000; 85: 3803-3807
31 Kaji H , Kishimoto M , Kirimura T , Iguchi G , Murata M , Yoshioka S , Iida K , Okimura Y, Yoshimoto Y, Chihara K. Hormonal regulation of the human ghrelin receptor gene transcription. Biochem Biophys Res Commun 2001; 284: 660-666
32 Petersenn S, Rasch AC, Penshorn M, Beil FU, Schulte HM. Genomic struc- ture and transcriptional regulation of the human growth hormone secretagogue receptor. Endocrinology 2001; 142: 2649-2659
Downloaded by: University of Georgia Libraries. Copyrighted material.