B-Type Natriuretic Peptide Inhibited Angiotensin II-Stimulated Cholesterol Biosynthesis, Cholesterol Transfer, and Steroidogenesis in Primary Human Adrenocortical Cells
Faquan Liang,* Ann M. Kapoun,* Andrew Lam, Debby L. Damm, Diana Quan, Maile O’Connell, and Andrew A. Protter
Scios, Inc., Fremont, California 94555
In this study, we demonstrate that B-type natriuretic peptide (BNP) opposed angiotensin II (Ang II)-stimulated de novo cho- lesterol biosynthesis, cellular cholesterol uptake, cholesterol transfer to the inner mitochondrial membrane, and steroido- genesis, which are required for biosynthesis of steroid hor- mones such as aldosterone and cortisol in primary human adrenocortical cells. BNP dose-dependently stimulated intra- cellular cGMP production with an EC50 of 11 nM, implying that human adrenocortical cells express the guanylyl cyclase A receptor. cDNA microarray and real-time RT-PCR analyses revealed that BNP inhibited Ang II-stimulated genes related to cholesterol biosynthesis (acetoacetyl coenzyme A thiolase, HMG coenzyme A synthase 1, HMG coenzyme A reductase, isopentenyl-diphosphate 4-isomerase, lanosterol synthase, sterol-4C-methyl oxidase, and emopamil binding protein/ste- rol isomerase), cholesterol uptake from circulating lipopro- teins (scavenger receptor class B type I and low-density li-
poprotein receptor), cholesterol transfer to the inner mitochondrial membrane (steroidogenic acute regulatory protein), and steroidogenesis (ferredoxin 1,3ß-hydroxys- teroid dehydrogenase, glutathione transferase A3, CYP19A1, CYP11B1, and CYP11B2). Consistent with the microarray and real-time PCR results, BNP also blocked Ang II-induced bind- ing of 125I-labeled low-density lipoprotein and 125I-labeled high-density lipoprotein to human adrenocortical cells. Fur- thermore, BNP markedly inhibited Ang II-stimulated release of estradiol, aldosterone, and cortisol from cultured primary human adrenocortical cells. These findings demonstrate that BNP opposes Ang II-induced steroidogenesis via multiple steps from cholesterol supply and transfer to the final forma- tion of steroid hormones. This study provides new insights into the cellular mechanisms by which BNP modulates Ang II-induced steroidogenesis in the adrenal gland. (Endocrinol- ogy 148: 3722-3729, 2007)
T HE RENIN-ANGIOTENSIN-ALDOSTERONE system has been implicated in a series of cardiovascular dis- eases. Angiotensin II (Ang II) is a vasoactive peptide hor- mone that potently stimulates aldosterone synthesis in the adrenal cortical cells, which results in sodium and water retention, cardiac fibrosis, and inflammation, leading to hy- pertension, heart failure, and renal failure (1-5). It also stim- ulates cortisol release from human adrenal cells, which may also contribute to the pathophysiology of this neurohormone (6, 7).
Adrenal steroidogenesis starts from cholesterol, which is a common precursor of all steroid hormones. Cholesterol can be provided either by de novo biosynthesis from acetyl co- enzyme A or circulating low- and high-density lipoproteins. The uptake of low-density lipoprotein (LDL) involves bind- ing of the LDL particles to specific cell surface receptors
termed LDL receptors (LDLR) followed by internalization of the lipoprotein-receptor complex and lysosomal hydrolysis leading to the release of cholesterol esters (8). In contrast, the delivery of cholesterol from high-density lipoprotein (HDL) takes place through scavenger receptor class B type I (SR-BI) on the cell surface without the internalization and degrada- tion of lipoprotein particles (9-11). The interaction of HDL with SR-BI leads to the formation of a nonaqueous channel through which cholesterol esters move down their concen- tration gradient to the plasma membrane (10). The lipid-poor HDL then dissociate from the cells and reenter the circula- tion. SR-BI also binds native LDL and modified LDL and mediates the cholesterol supply from LDL to steroidogenic cells and other types of cells (12, 13). Cholesterol is converted to pregnenolone, which is used for the synthesis of three main families of steroid hormones including aldosterone, cortisol, and sex hormones.
Atrial natriuretic peptide and B-type natriuretic peptide (BNP) are cardiac-derived peptide hormones that counteract the renin-angiotensin-aldosterone system, endothelin, and hemodynamic forces that promote the progression of heart failure. Both atrial natriuretic peptideand BNP have been previously shown to inhibit Ang II-induced aldosterone syn- thesis in adrenal glomerulosa cells (14-16). However, it re- mains unclear whether Ang II and natriuretic peptides reg- ulate the cholesterol biosynthesis, cholesterol transfer, and
First Published Online May 3, 2007
* F.L. and A.M.K. contributed equally to this work.
Abbreviations: Ang II, Angiotensin II; BNP, B-type natriuretic pep- tide; FDX, ferredoxin; FDXR, ferredox reductase; GST, glutathione trans- ferase; HDL, high-density lipoprotein; HMGCR, HMG coenzyme A reductase; LDL, low-density lipoprotein; LDLR, LDL receptor; SR-BI, scavenger receptor class B type I; StAR, steroidogenic acute regulatory protein.
Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.
| Reverse | CTGGGTGCAGAGACGTGATTAG AACTACTGAACACACCTGGAATGATT | GCCATTACGGTCCCACACA | TAATGCTCTGTGCCAGTATTTGC | ATAACACAAATGCCAAATGTACACAGT | GGAGACCCTCTGAGATTCTGCTT TCTTGTGCTCACTCCATTGTTTTC | ||
|---|---|---|---|---|---|---|---|
| Probe | |||||||
| CCCCCTCCTCACCTTCAGAGCCATC AGCGTTTGTTCCCCCATGAAAGGG | TTTGGGCCCCGTGGCTGTG CACCATGGCGATGTACTTTCC CCCGGCAGCTTGCCCGAATT | TGGGTTTTCTCAAAGTCCATTGCCGG | TTCCCGTGGTCTCCTTGCAC | CATGCGCTGGCAGTACATGTGCAC CCAGGCAAAGCGCCTTTACACA | |||
| Forward | GCTCCTGGTAGCTGATGAGGAT CCAAGAGGACATAAAGATGGTCTACA | CCTTATAGGTACTTTCAGCCATTTGG TGTTCAAGGAGCATGCAAAGA | TTAACTTTTGGGTGCCAGGAA | CCCGACCCCTACCCACTT | AGCTTTGGCCTTGGTCTACCT TTGCTTTATGGGCTCAAGAATG | ||
| Genes | CYP11B1 CYP11B2 | CYP19A1 LDLR HMGCR HMGCS1 | STAR SCARB1 | ||||
50
CGMP (pmol/106 cell)
40-
30
20
10-
0
-10
-9
-8
-7
-6
-5
log[BNP (M)]
steroid synthetic pathways that are required for adrenal ste- roidogenesis. Of note, most human adrenal cell studies were performed using the H295R cell line, a transformed human adrenocorticocarcinoma cell. This transformed cell line may not appropriately reflect the features of primary human ad- renal cells. In this study, we isolated primary human adre- nocortical cells from human adrenal gland and demonstrated that BNP exerted a broad functional opposition to Ang II, including cholesterol biosynthesis, cholesterol uptake, cho- lesterol transfer, and steroidogenesis.
Materials and Methods
Ang II was purchased from Sigma Chemical Co. (St. Louis, MO). Human BNP was obtained from American Peptide Co. (Sunnyvale, CA). [125]]HDL and [125]]LDL were obtained from Biomedical Technologies (Stoughton, MA). All other reagents were provided by commercial sources.
Isolation and culture of human adrenocortical cells
Three human adrenal glands donated by a 50-yr-old white man (donor 1), a 20-yr-old white man (donor 2), and a 63-yr-old white man (donor 3) were purchased from Tissue Transformation Technology (Edi- son, NJ), kept in oxygenized buffer, and shipped to Scios Inc. within 24 h. Adrenal cortex was dissected and digested with 0.25% collagenase I. The freshly isolated cells were cultured in DMEM containing 10% fetal bo- vine serum for 3 d. Cells were changed to serum-free medium and treated with 200 nm human BNP in the presence or absence of 100 nm Ang II for 24 h. Pooled biological duplicate cells isolated from donor 1 were used for microarray analysis. Cultured human adrenocortical cells were mixed populations including glomerulosa cells, fasciculata cells, and reticularis cells that synthesize all types of steroid hormones.
Intracellular cGMP assay
Human adrenocortical cells were preincubated with 0.1 mM 3-isobu- tyl-1-methylxanthine for 1 h before treatment of increasing concentra- tions of BNP for 10 min. Cells were lysed with 0.1 M HCI at room temperature for 20 min. The lysates were centrifuged, and the levels of cGMP in the supernatant were measured using a cGMP enzyme im- munoassay kit from Assay Designs (Ann Arbor, MI).
cDNA microarray
Gene expression profiles were determined as previously described (17) from cDNA microarrays containing 8600 elements derived from clones isolated from normalized cDNA libraries or purchased from ResGen (Invitrogen Life Technologies, Carlsbad, CA). Fluorescently la- beled cDNA probes were prepared from pooled mRNAs generated from
A
B
C
duplicate wells of cells from four groups: control (unstimulated), 100 nm Ang II, 200 nM BNP, and the combination of Ang II and BNP. Quadru- plicate hybridizations were performed. Differential expression values were expressed as the ratio of the median of background-subtracted fluorescent intensity of the experimental RNA to the median of back- ground-subtracted fluorescent intensity of the control RNA. For ratios of 1.0 or more, the ratio was expressed as a positive value. For ratios less than 1.0, the ratio was expressed as the negative reciprocal (i.e. a ratio of 0.5 = - 2.0).
Real-time RT-PCR
Real-time RT-PCR was performed in a two-step manner. cDNA syn- thesis and real-time detection were carried out in a PTC-100 Thermal Cycler (MJ Research, Waltham, MA) and an ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA), respectively. Random hexamers (QIAGEN, Valencia, CA) were used to generate cDNA from 200 ng RNA, as described in Applied Biosystems User Bulletin No. 2. TaqMan PCR Core Reagent Kit or TaqMan Universal PCR Master Mix (Applied Biosystems) was used in subsequent PCR accord- ing to the manufacturer’s protocols. Relative quantitation of gene ex- pression was performed using the relative standard curve method. All real-time RT-PCR were performed in triplicate.
Sequence-specific primers and probes were designed using Primer Express version 2 software (Applied Biosystems). Sequences of primers and probes are shown in Table 1. Expression levels were normalized to 18S rRNA. The selection of 18S rRNA as an endogenous control was based on an evaluation of the ACT levels (Applied Biosystems document no. 4308134C) of the following six housekeeping genes: cyclophilin A, 18S, GAPDH, B-actin, ß-glucuronidase, and hypoxanthine guanine phosphoribosyl transferase. The ACT levels of 18S did not differ significantly between treatment conditions; thus, they were expressed at constant levels be- tween samples (data not shown).
Binding of 125I-labeled lipoproteins
Human adrenocortical cells were pretreated with 100 nm Ang II in the presence or absence of 200 nM BNP for 24 h and then incubated with fresh serum-free medium containing different concentrations of [125I]LDL or [125]]HDL at 37 C for 1 h. For nonspecific binding, 2.5 mg/ml of unlabeled LDL or HDL was included in the medium. Cells were washed and lysed with 1 M NaOH. The radioactivity in the lysates was counted using a Beckman y-counter.
Steroid hormone measurement
Human adrenocortical cells were treated with 100 nm Ang II in the presence or absence of 200 nm BNP for 24 h. The conditioned medium was saved for steroid measurements. The levels of cortisol and estradiol were measured using enzyme immunoassay kits provided by Assay Designs, Inc. The aldosterone content in the conditioned medium was measured using the aldosterone RIA kit from Diagnostic Products Inc. (Los Angeles, CA).
Statistical analysis
Data were analyzed by ANOVA with the Newman-Keuls test to assess statistical significance.
Results
BNP induced cGMP synthesis in human adrenocortical cells
BNP binds to type-A natriuretic peptide receptor, leading to the generation of cGMP, which mediates biological effects of the peptide. Cultured human adrenocortical cells were treated with increasing concentrations of BNP for 10 min and then subjected to cGMP assay. BNP dose-dependently stim- ulated intracellular cGMP production in human adrenocor- tical cells with an EC50 of 11 nM (Fig. 1), suggesting human
adrenocortical cells express type-A natriuretic peptide receptor.
Effect of BNP on Ang II-regulated gene expression
To determine the effect of BNP on Ang II-induced gene expression profiles in human adrenocortical cells, we per- formed a cDNA microarray analysis. The cells were treated with 100 nm Ang II in the presence or absence of 200 nM BNP for 24 h. Arrays were probed in quadruplicate for a total of 12 hybridizations as follows: control vs. Ang II, Ang II vs. the combination of Ang II and BNP, and control vs. BNP. The cDNA microarray analysis revealed that Ang II treatment resulted in 80 gene expression changes with up-regulation of 49 genes and down-regulation of 31 genes in human adre- nocortical cells. These differentially expressed genes repre- sent about 1% of total genes on the array. BNP opposed 49% of Ang II-regulated genes in primary human adrenocortical cells. In addition, a small number of genes were down-reg- ulated in the cells treated with BNP alone. A hierarchical cluster analysis was performed to identify gene expression patterns affected by Ang II and BNP. A visualization of this analysis is shown in Fig. 2. A complete listing of differentially expressed genes is provided in the table published as sup- plemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org.
BNP opposed Ang II-stimulated genes related to cholesterol biosynthesis, cholesterol uptake, cholesterol transfer, and steroidogenesis
The adrenal steroidogenesis requires de novo cholesterol biosynthesis, uptake of cholesterol into the cells, cholesterol transfer to mitochondria, and steroid synthesis. A number of genes responsible for cholesterol biosynthesis were up-reg- ulated in the cells stimulated with Ang II. This regulation was inhibited by cotreatment with BNP (Table 2). These genes include acetoacetyl coenzyme A thiolase (ACAT2), HMG- coenzyme A synthase 1 (HMGCS1), isopentenyl-diphos- phate 4-isomerase (IPP isomerase: IDI1), lanosterol synthase
(LSS), sterol-4 C-methyl oxidase (SC4MOL), and emopamil binding protein (EBP) or sterol-48-47-isomerase. In addition, farnesyl-diphosphate farnesyltransferase 1 (FDFT1) cata- lyzes the farnesylation of a series of products including H- Ras, N-Ras, K-Ras, Rho B, Rho D, and Rho E, which are involved in cell signaling processes. This gene was also in- duced by Ang II and blocked by BNP.
SB-RI and LDLR are two major membrane receptors re- sponsible for uptake of cholesterol from circulating lipopro- teins into steroidogenic cells. The cDNA microarray analysis demonstrated that Ang II induced the expression of both SR-BI (3-fold increase) and LDLR (1.8-fold increase), and BNP markedly inhibited the induction of SR-BI and LDLR in primary human adrenocortical cells stimulated with Ang II (Table 2).
The steroidogenic acute regulatory protein (StAR) mod- ulates the acute stimulation of steroid synthesis in steroido- genic cells (18-20). StAR interacts with the outer mitochon- drial membrane and facilitates the rate-limiting transfer of cholesterol to the inner mitochondrial membrane where it is converted to pregnenolone by the cholesterol side-chain cleavage cytochrome P450scc system. Here, we showed that StAR expression was also up-regulated by Ang II, and BNP inhibited this induction in primary human adrenocortical cells (Table 2).
Several genes involved in the steroid synthetic pathway were induced by Ang II and opposed by BNP (Table 2). Another rate-limiting step for steroid synthesis is the con- version of cholesterol to pregnenolone, catalyzed by the cho- lesterol side-chain cleavage cytochrome P450scc system. This system consists of three components: ferredoxin (FDX), ferre- dox reductase (FDXR), and the terminal cytochrome P450. Ang II stimulated the expressions of both FDX and its re- ductase FDXR, which were opposed by BNP. 36-Hydroxys- teroid dehydrogenase (HSD3B1) isoenzymes are responsible for the oxidation and isomerization of 45-3ß-hydroxysteroid precursors into 44-ketosteroids, thus catalyzing an essential step required for the synthesis of all active steroid hormones.
| Genes | Ang II | Ang II + BNP | BNP | Full name |
|---|---|---|---|---|
| Cholesterol synthesis | ||||
| ACAT2 | 1.8 | -1.8 | -1.1 | Acetoacetyl coenzyme A thiolase |
| HMGCS1 | 2.6 | -2.1 | 1.0 | HMG-coenzyme A synthase 1 |
| HMGCR | 1.6 | -1.5 | -1.1 | HMG-coenzyme A reductase |
| MVK | 2.2 | -1.3 | -1.1 | Mevalonate kinase |
| IDI1 | 1.8 | -1.6 | 1.0 | Isopentenyl-diphosphate 4-isomerase |
| FDFT1 | 1.8 | -1.7 | -1.1 | Farnesyl-diphosphate farnesyltransferase 1 |
| LSS | 1.8 | -1.7 | 1.2 | Lanosterol synthase |
| SC4MOL | 3.1 | -2.4 | 1.0 | Sterol-4C-methyl oxidase |
| EBP | 2.4 | -2.2 | -1.3 | Emopamil binding protein |
| Cholesterol transfer | ||||
| SCARB1 | 3.0 | -2.2 | -1.1 | Scavenger receptor class B, member 1 |
| LDLR | 1.8 | -1.4 | 1.2 | Low-density lipoprotein receptor |
| STAR | 1.7 | -1.6 | 1.2 | Steroidogenic acute regulator |
| Steroid synthesis | ||||
| FDX1 | 2.8 | -1.9 | 1.0 | Ferredoxin 1 |
| FDXR | 1.9 | -1.4 | -1.0 | Ferredoxin reductase |
| HSDB1 | 4.1 | -4.6 | -1.2 | 3ß-Hydroxysteroid dehydrogenase 1 |
| CYP19A1 | 7.8 | -5.2 | -1.2 | Aromatase or estrogen synthetase |
| CYP11B1 | 5.8 | -4.6 | -1.4 | Steroid 11ß-monooxygenase |
| GSTA3 | 1.8 | -1.7 | -1.2 | Glutathione S-transferase A3 |
Recently, a novel human glutathione transferase (GST) of the a-class denoted GST A3-3 was identified to have the same function as HSD3B1, but with about 230 times the efficiency to catalyze the isomerization reaction (21, 22). The expression of these two enzymes was stimulated by Ang II, and the stimulation was inhibited by BNP. Moreover, the genes en- coding the enzymes involved in the final step of aldosterone, cortisol, and estradiol synthesis (CYP11B1, CYP11B2, and CYP19A1) were also up-regulated in the cells treated with Ang II, and this induction was blocked when cotreated with BNP. CYP11B2 was analyzed by real-time RT-PCR because this gene was not printed in this array.
Genes involved in cell growth and differentiation were also regulated by Ang II and affected by BNP. These include insulin-induced gene 1 (INSIG1), integrin @7 (ITGA7), in- hibin « (INHA), CDC2-related protein kinase 7 (CRK7), CDC 42 binding protein kinase « (CDC42BPA), ring finger protein 1 (RING1), and matrix Gla protein (MGP). These genes may associate with Ang II-stimulated adrenocortical cell growth
or hyperplasia, which may be also involved in the excess of steroid hormone synthesis.
Validation of microarray by real-time RT-PCR
To verify the microarray data, real-time RT-PCR was per- formed to analyze the expression of eight representative genes involved in cholesterol supply, cholesterol transfer, and steroidogenesis. Consistent with the microarray results, real-time RT-PCR analyses confirmed that the genes encod- ing HMGCS1, SR-BI, LDLR, StAR, CYP11B1, CYP11B2, and CYP19A1 were up-regulated by Ang II, and this induction was inhibited by BNP in cultured primary human adreno- cortical cells isolated from three individual donors (Fig. 3). HMG coenzyme A reductase (HMGCR) is a rate-limiting enzyme that converts HMG-CoA to mevalonate during cho- lesterol biosynthesis. It has been previously shown that the expression and activity of this enzyme were highly induced by ACTH in human adrenal cortex (23, 24). The expression of HMGCR did not meet expression fold criteria used for our
5.0
3.0
HMGCS1/18s
4.0
HMGCR/18s
2.5
3.0
2.0
1.5
2.0
1.0
1.0
0.5
0.0
0.0
Donor1
Donor2
Donor3
Donor1
Donor2
Donor3
4.0
3.0
SCARB/18s
3.0
LDLR/18s
2.5
2.0
2.0
1.5
1.0
1.0
0.5
0.0
0.0
Donor1
Donor2
Donor3
Donor1
Donor2
Donor3
5.0
25
StAR/18s
4.0
CYP19A1/18s
20
3.0
15
2.0
10
1.0
5
0.0
0
Donor1
Donor2
Donor3
Donor1
Donor2
Donor3
10.0
20
CYP11B1/18s
8.0
CYP11B2/18S
15
6.0
4.0
10
2.0
5
0.0
0
Donor1
Donor2
Donor3
Donor1
Donor2
Donor3
microarray analysis, but real-time PCR demonstrated that Ang II stimulated a 1.5- to 3-fold increase in HMGCR mRNA. BNP completely opposed this stimulation in the cultured cells from all three donors. The differential results for HMGCR may reflect the lower sensitivity of the microarray compared with real-time RT-PCR, suggesting also that other gene expression differences may exist that are not detected by the microarray analysis.
Effect of BNP on lipoprotein binding stimulated by Ang II
Our microarray and real-time RT-PCR data demonstrated that BNP opposed Ang II-stimulated expression of SR-BI and LDLR in human adrenocortical cells. Because cholesterol uptake requires binding of lipoproteins to these two recep- tors, we performed a lipoprotein binding assay. Cultured primary human adrenocortical cells were pretreated with 100 nM Ang II in the presence or absence of 200 nM BNP for 24 h and then incubated with increasing concentrations of [125I]LDL or [125]]HDL at 37 C for 1 h as described in Materials and Methods. Consistent with microarray and real-time RT- PCR results, the binding of [125I]LDL or [125]]HDL was sig-
1251-LDL Binding (cpm)
2500
∗
2000
∗
1500
**
1000
**
T
∗
T
T
500
T
T
T
**
0
5
25
50
125
I-LDL (µg/ml)
Control
BNP
AII
AII+BNP
1500
∗
1251-HDLBinding (cpm)
T
1000
∗
**
**
T
I
T
T
T
T
T
500
**
T
T
T
0
T
5
25
50
125
I-HDL (µg/ml)
Control
BNP
AII
AII+BNP
nificantly increased in the cells pretreated with Ang II and decreased when the cells were pretreated with Ang II in the presence of BNP (Fig. 4). There was no significant change of lipoprotein binding in the cells pretreated with BNP alone.
BNP inhibited Ang II-induced steroidogenesis
To further examine the effect of BNP on Ang II-dependent steroidogenesis, we measured steroid production in the con- ditioned medium of cultured primary human adrenocortical cells. Treatment of the cells with 100 nm Ang II for 24 h resulted in a significant increase in the release of aldosterone, cortisol, and estradiol. BNP significantly lowered Ang II- induced release of these steroid hormones from human ad- renocortical cells (Fig. 5). Noteworthily, we observed that the level of cortisol was 1000-fold higher than the level of aldo- sterone in the conditioned medium collected from cultured primary human adrenocortical cells, suggesting cortisol may
600
Aldosterone (pg/ml)
500
T
400
T
300
200
100
7
0
0
1
10
100
1000
BNP (nM)
Basal
Ang II
5000
Cortisol (ng/ml)
4000
3000
2000
T
1000
T
T
0
Donor 1
Donor 2
Donor 3
Control
BNP
AII
AII+BNP
500
Estradiol (pg/ml)
400
300
200
T
T
100
T
T
T
0
Donor 1
Donor 2
Donor 3
Control
BNP
AII
AII+BNP
∗
Ang II
BNP
BNP
Cholesterol biosynthesis ACAT2, HMGCS1, HMGCR, LSS, EMP
F
BNP
Cholesterol uptake/transfer SB-RI, LDLR, StAR
Steroidogenesis
FDX1, HSD3B1, GSTA3, CYP19A1, CYP11B1, CYP11B2
be also critical for contributing to the pathophysiology of Ang II.
Discussion
In this study, we demonstrate for the first time that BNP broadly opposes Ang II-stimulated steroidogenesis, includ- ing de novo cholesterol biosynthesis, uptake of cholesterol into adrenal cells, transfer of cholesterol into mitochondria, and steroid synthesis in primary human adrenocortical cells.
De novo cholesterol biosynthesis
One source of cholesterol supply is provided by de novo synthesis within the adrenocortical cells starting from acetyl coenzyme A. This synthetic pathway requires many enzymes and their cooperative regulation in the cell. Previously, it was not known whether Ang II and natriuretic peptides affect the expression of these enzymes and modulate cholesterol bio- synthesis in adrenal cells. Here, we provided the first dem- onstration that Ang II increased cholesterol synthesis through up-regulation of several enzyme genes including ACAT2, HMGCS1, HMGCR1, IDI1, LSS, SC4MOL, and EBP, and BNP opposed Ang II-induced cholesterol synthesis by inhibiting the expression of these up-regulated enzyme genes in human adrenocortical cells. These findings suggest that BNP may inhibit Ang II-induced adrenal steroidogen- esis through modulation of de novo cholesterol biosynthesis.
Cholesterol uptake
Another major source of cholesterol supply for adrenal steroidogenesis is from circulating lipoproteins such as LDL and HDL. Uptake of cholesterol from LDL is mainly medi- ated through LDLR in the surface of adrenocortical cells, whereas the membrane receptor SR-BI is responsible for de- livery of cholesterol from HDL into the cells (8-11). Regu- lation of SR-BI and LDLR by Ang II has been previously studied in the human NCI-H295R adrenocortical carcinoma cell line. Cherradi et al. (25) reported that Ang II increased SR-BI expression with minimal effect on LDLR in the NCI-
H295R cell line. Similarly, Pilon et al. (26) showed that Ang II stimulated SR-BI, but not LDLR, expression in the NCI- H295 cell line. Interestingly, they found that Ang II increased not only HDL binding and HDL-derived cholesterol uptake but also LDL binding and LDL-derived cholesterol uptake when the LDLR pathway was inhibited. This suggests that SR-BI may also mediate cholesterol uptake from LDL for steroidogenesis. Consistent with their findings, our data demonstrated that Ang II induced SR-BI expression and in- creased the binding and uptake of both HDL and LDL in primary human adrenocortical cells. The difference from their studies is that our microarray data showed Ang II significantly stimulated LDLR expression, and the result was confirmed by real-time RT-PCR from the cells isolated from three individual donors. The discrepant results may be de- rived from different cell types used in each study. Although multiple pathways for steroidogenesis were confirmed in NCI-295 cells, this transformed cell line may not completely reflect the features of human adrenocortical cells.
The study reported here demonstrated that BNP inhibited Ang II-induced expression of SR-BI and LDLR as well as uptake of cholesterol from HDL and LDL into human ad- renocortical cells, providing another cellular mechanism by which BNP suppresses Ang II-stimulated steroidogenesis.
Cholesterol transfer into mitochondria
The rate-limiting step in the activation of steroidogenesis is the delivery of cholesterol from the mitochondrial outer membrane to the inner membrane where cholesterol under- goes an enzymatic cascade leading eventually to the forma- tion of steroids. Identification of mutations in humans and mouse knockout studies demonstrated that StAR is critical for facilitation of cholesterol movement to mitochondria for steroidogenesis. A number of studies showed that the ex- pression of StAR was up-regulated by Ang II in human NCI-H295R adrenocortical carcinoma cells (27-29). In this study, we demonstrated that BNP completely blocked Ang II-stimulated StAR expression in human adrenocortical cells, indicating BNP may also control Ang II-induced adrenal ste- roidogenesis by limitation of cholesterol transfer to the mito- chondrial inner membrane for initiation of steroid synthesis.
Steroidogenesis
Three novel findings related to the steroid synthetic path- way were reported in this study: 1) Ang II up-regulated a number of enzymes involved in steroid synthesis, including FDX1, FDXR, 3BHSD1, GSTA3, CYP19A1, CYP11B1, and CYP11B2; 2) BNP inhibited the stimulation of these enzymes by Ang II in primary human adrenocortical cells; and 3) BNP inhibited the release of aldosterone, cortisol, and estradiol in human adrenocortical cells. The excess in aldosterone and cortisol synthesis has been linked to a series of cardiovascular diseases such as hypertension, atherosclerosis, heart failure, and renal failure. The inhibitory effect of BNP on Ang II- stimulated aldosterone and cortisol production suggests a beneficial role for BNP in treatment of cardiovascular dis- eases. Interestingly, we found that CYP19A1 or aromatase responsible for the conversion of adrenal androgen to estro- gen was strongly up-regulated in human adrenocortical cells
treated with Ang II and inhibited when cotreated with BNP. These results were further confirmed by the measurement of estrogen release in the conditioned media. Consistent with our findings, Kalenga et al. (30) reported that Ang II induced the secretion of estradiol from human placenta, and this effect seems to be linked to the stimulation of local androgen aromatization. The biological significance of Ang II-induced estrogen release is still unclear. Studies from Koh et al. (31) showed that women with the high-activity genotype of the ACE gene had an increased risk of developing breast cancer when compared with those possessing low-activity ACE ge- notype, suggesting that the renin-angiotensin system may link to breast cancer incidence. The aromatase inhibitors have been used to treat advanced breast cancer, especially in postmeno- pausal women (32).
In conclusion, this study demonstrates that BNP counter- balances Ang II-induced steroidogenesis via multiple steps from the cholesterol supply and transfer to the final forma- tion of steroid hormones (Fig. 6). These findings provide new insights into the cellular mechanisms by which BNP mod- ulates Ang II-induced steroidogenesis in the adrenal gland.
Acknowledgments
Received November 29, 2006. Accepted April 23, 2007.
Address all correspondence and requests for reprints to: Andrew A. Protter, Ph.D., Scios Inc., 6500 Paseo Padre Parkway, Fremont, California 94555. E-mail: andyprotter@mac.com.
Disclosure statement: All the authors have nothing to disclose.
References
1. Nadler JL, Natarajan R, Stern N 1987 Specific action of the lipoxygenase pathway in mediating angiotensin II-induced aldosterone synthesis in isolated adrenal glomerulosa cells. J Clin Invest 80:1763-1769
2. Natarajan R, Stern N, Nadler J 1988 Diacylglycerol provides arachidonic acid for lipoxygenase products that mediate angiotensin II-induced aldosterone synthesis. Biochem Biophys Res Commun 156:717-724
3. Stern N, Natarajan R, Tuck ML, Laird E, Nadler JL 1989 Selective inhibition of angiotensin-II-mediated aldosterone secretion by 5-hydroxyeicosatetra- enoic acid. Endocrinology 125:3090-3095
4. Fuller PJ, Young MJ 2005 Mechanisms of mineralocorticoid action. Hyper- tension 46:1227-1235
5. Young M, Funder JW 2000 Aldosterone and the heart. Trends Endocrinol Metab 11:224-226
6. Bird IM, Meikle I, Williams BC, Walker SW 1989 Angiotensin II-stimulated cortisol secretion is mediated by a hormone-sensitive phospholipase C in bovine adrenal fasciculata/reticularis cells. Mol Cell Endocrinol 64:45-53
7. Rabano M, Pena A, Brizuela L, Macarulla JM, Gomez-Munoz A, Trueba M 2004 Angiotensin II-stimulated cortisol secretion is mediated by phospholipase D. Mol Cell Endocrinol 222:9-20
8. Brown MS, Goldstein JL 1986 A receptor-mediated pathway for cholesterol homeostasis. Science 232:34-47
9. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL 1997 Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci USA 94:13600-13605
10. Williams DL, Connelly MA, Temel RE, Swarnakar S, Phillips MC, de la Llera-Moya M, Rothblat GH 1999 Scavenger receptor BI and cholesterol trafficking. Curr Opin Lipidol 10:329-339
11. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M 1996 Identification of scavenger receptor SR-BI as a high density lipoprotein re- ceptor. Science 271:518-520
12. Swarnakar S, Temel RE, Connelly MA, Azhar S, Williams DL 1999 Scavenger receptor class B, type I, mediates selective uptake of low density lipoprotein cholesteryl ester. J Biol Chem 274:29733-29739
13. Stangl H, Hyatt M, Hobbs HH 1999 Transport of lipids from high and low density lipoproteins via scavenger receptor-BI. J Biol Chem 274:32692-32698
14. Kudo T, Baird A 1984 Inhibition of aldosterone production in the adrenal glomerulosa by atrial natriuretic factor. Nature 312:756-757
15. Chartier L, Schiffrin E, Thibault G, Garcia R 1984 Atrial natriuretic factor inhibits the stimulation of aldosterone secretion by angiotensin II, ACTH and potassium in vitro and angiotensin II-induced steroidogenesis in vivo. Endo- crinology 115:2026-2028
16. Hashiguchi T, Higuchi K, Ohashi M, Minamino N, Kangawa K, Matsuo H, Nawata H 1988 Porcine brain natriuretic peptide, another modulator of bovine adrenocortical steroidogenesis. FEBS Lett 236:455-461
17. Kapoun AM, Gaspar NJ, Wang Y, Damm D, Liu YW, O’Young G, Quon D, Lam A, Munson K, Tran TT, Ma JY, Murphy A, Dugar S, Chakravarty S, Protter AA, Wen FQ, Liu X, Rennard SI, Higgins LS 2006 Transforming growth factor-ß receptor type 1 (TGFØRI) kinase activity but not p38 activation is required for TGFBRI-induced myofibroblast differentiation and profibrotic gene expression. Mol Pharmacol 70:518-531
18. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314-28322
19. Lin D, Sugawara T, Strauss 3rd JF, Clark BJ, Stocco DM, Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:1828-1831
20. Clark BJ, Soo SC, Caron KM, Ikeda Y, Parker KL, Stocco DM 1995 Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 9:1346-1355
21. Johansson AS, Mannervik B 2001 Human glutathione transferase A3-3, a highly efficient catalyst of double-bond isomerization in the biosynthetic path- way of steroid hormones. J Biol Chem 276:33061-33065
22. Johansson AS, Mannervik B 2002 Active-site residues governing high steroid isomerase activity in human glutathione transferase A3-3. J Biol Chem 277: 16648-16654
23. Lehoux JG, Lefebvre A, Belisle S, Bellabarba D 1989 Hormonal regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase mRNA in the rat adrenal gland. J Steroid Biochem 34:379-384
24. Lehoux JG, Lefebvre A, De Medicis E, Belisle S, Bellabarba D 1989 The enhancing effect of adrenocorticotropin on adrenal 3-hydroxy-3-methylglu- taryl coenzyme A reductase messenger ribonucleic acid level is inhibited by aminoglutethimide but not by cycloheximide. Endocrinology 125:158-164
25. Cherradi N, Bideau M, Arnaudeau S, Demaurex N, James RW, Azhar S, Capponi AM 2001 Angiotensin II promotes selective uptake of high density lipoprotein cholesterol esters in bovine adrenal glomerulosa and human ad- renocortical carcinoma cells through induction of scavenger receptor class B type I. Endocrinology 142:4540-4549
26. Pilon A, Martin G, Bultel-Brienne S, Junquero D, Delhon A, Fruchart JC, Staels B, Clavey V 2003 Regulation of the scavenger receptor BI and the LDL receptor by activators of aldosterone production, angiotensin II and PMA, in the human NCI-H295R adrenocortical cell line. Biochim Biophys Acta 1631: 218-228
27. Clark BJ, Pezzi V, Stocco DM, Rainey WE 1995 The steroidogenic acute regulatory protein is induced by angiotensin II and K+ in H295R adrenocor- tical cells. Mol Cell Endocrinol 115:215-219
28. Pezzi V, Clark BJ, Ando S, Stocco DM, Rainey WE 1996 Role of calmodulin- dependent protein kinase II in the acute stimulation of aldosterone production. J Steroid Biochem Mol Biol 58:417-424
29. Clark BJ, Combs R 1999 Angiotensin II and cyclic adenosine 3’,5’-monophos- phate induce human steroidogenic acute regulatory protein transcription through a common steroidogenic factor-1 element. Endocrinology 140:4390- 4398
30. Kalenga MK, De Gasparo M, Thomas K, De Hertogh R 1995 Angiotensin-II stimulates estradiol secretion from human placental explants through AT1 receptor activation. J Clin Endocrinol Metab 80:1233-1237
31. Koh WP, Yuan JM, Sun CL, van den Berg D, Seow A, Lee HP, Yu MC 2003 Angiotensin I-converting enzyme (ACE) gene polymorphism and breast can- cer risk among Chinese women in Singapore. Cancer Res 63:573-578
32. Buzdar AU 2001 A summary of second-line randomized studies of aromatase inhibitors. J Steroid Biochem Mol Biol 79:109-114
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.