ELSEVIER
Effects of PCBs and MeSO2 PCBs on adrenocortical steroidogenesis in H295R human adrenocortical carcinoma cells
Yan Xu ª,1, Richard M.K. Yu ª,1, Xiaowei Zhang a,b, Margaret B. Murphy a,b, John P. Giesy a,b, Michael H.W. Lam ª,*, Paul K.S. Lam ª, Rudolf S.S. Wu ª, Hongxia Yu ℃
a Centre for Coastal Pollution and Conservation, Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong SAR, China
b Department of Zoology, National Food Safety and Toxicology Centre, Centre for Integrative Toxicology, Michigan State University, East Lansing, MI 48824, United States
” State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210093, China
Received 28 February 2005; received in revised form 23 July 2005; accepted 3 August 2005 Available online 10 October 2005
Abstract
Some endocrine disrupting chemicals (EDCs) in the environment have been shown to exert their biological effects through interference with steroidogenesis. In this study, the potential effects of four selected polychlorinated biphenyl (PCB) congeners (PCB101, PCB110, PCB126 and PCB149) as well as several of their environmentally-relevant meth- ylsulfonyl-(MeSO2-) PCB metabolites (3’-MeSO2-CB101, 4’-MeSO2-CB101, 4’-MeSO2-CB110, 3’-MeSO2-CB149 and 4’-MeSO2-CB149) on adrenocortical steroidogenesis were evaluated by in vitro bioassay based on the human adreno- cortical carcinoma H295R cell line. The PCBs included in the study represented different structures and potential mech- anisms of action. Cells were exposed for 48 h to 10 uM of each PCB congener in the presence or absence of 20% (w/w) of their corresponding MeSO2-PCB metabolite(s). After the chemical treatments, changes in mRNA expression of 11 steroidogenic genes (CYP11A, CYP11B1, CYP11B2, CYP17, CYP19, CYP21, 36-HSD1, 3-HSD2, 17ß-HSD1, StAR and HMGR) were quantified using molecular beacon-based real-time RT-PCR. Genes coding for enzymes involved in the later or final steps of steroid production (CYP11B1, CYP11B2, CYP19, 30-HSD1, 36-HSD2 and 17B-HSD1) were up-regulated to various extents by most PCBs. The greatest transcriptional activations (2.8-29.9-fold) were elicited by PCB110 on CYP11B1, CYP11B2, 36-HSD2 and CYP19, and PCB149 on CYP11B1, 36-HSD1 and 17ß-HSD1. Increased expression of these steroidogenic genes might ultimately lead to a change in hormonal balance through exces- sive production of steroid hormones including aldosterone, cortisol and estradiol. In addition, co-treatment with 3’- and 4’-MeSO2-PCB149 resulted in a significant decrease in PCB149-induced 30-HSD1 and 170-HSD1 expression. This result indicates that some PCB congeners and their MeSO2-metabolites may affect steroidogenesis via different
Corresponding author. Tel .: +86 852 2788 7329; fax: +86 852 2788 7406.
E-mail address: bhmhwlam@cityu.edu.hk (M.H.W. Lam).
1 Joint first authors.
mechanisms. Overall, these findings suggest that PCBs and PCB metabolites can affect regulation of adrenocortical steroidogenesis.
@ 2005 Elsevier Ltd. All rights reserved.
Keywords: Polychlorinated biphenyls; MeSO2-PCBs; Steroidogenesis; H295R
1. Introduction
Polychlorinated biphenyls (PCBs) are one of the most ubiquitous and persistent groups of endocrine dis- rupting chemicals (EDCs) in the environment. Many of their effects are known to be receptor-mediated, and studies have demonstrated that PCBs can have both agonistic and antagonistic effects on the estrogen and androgen receptors, ER and AR, respectively (reviewed by Ulrich and Stahlmann, 2004), as well as effects that are mediated by the aryl hydrocarbon receptor (AhR). In general, effects of PCB on the ER are dependent on chlorination, with less chlorinated PCBs (<48% chlorine content) such as Aroclor 1248, 1242, etc., acting as estro- gen mimics, and the heavily chlorinated PCBs such as Aroclor 1254, 1260, 1262, 1268 and 4465 acting as estro- gen antagonists (reviewed by Foster, 1995). Similarly, PCBs have been reported to be AR antagonists, although Aroclor 1254 has also been demonstrated to be a weak AR agonist (reviewed by Ulrich and Stahl- mann, 2004).
In terms of AhR activity, some PCB congeners are structurally analogous to polychlorinated-dibenzo-p- dioxins while others are not. Congeners that are struc- turally similar to the dioxins are those that are not chlorinated in the ortho positions, which are often re- ferred to as the coplanar congeners as they can achieve a coplanar configuration that allows them to bind with high affinity to the AhR. Alternatively, di-ortho-substi- tuted congeners do not bind to the AhR, but act through different mechanisms of toxic action (Giesy and Kannan, 1998; van den Berg et al., 1998). PCB binding to the AhR can also result in antiestrogenic effects due to cross-talk between the AhR and the ER (Safe et al., 1998).
In addition to these receptor-mediated processes, PCBs have also been shown to alter or inhibit hormone production by steroidogenic tissue in reproductive or- gans (Andric et al., 2001; Gregoraszczuk and Wojto- wicz, 2002; Fukuzawa et al., 2003). For example, Aroclor 1248 and 1260 interrupted testicular steroido- genesis in rats through the inhibition of 3ß-hydroxyster- oid dehydrogenase (3ß-HSD), which catalyzes the conversion of pregnenolone to progesterone (Andric et al., 2001). Aroclor 1254 significantly reduced the over- all conversion of progesterone to other steroid products in guinea pig adrenal microsomes, largely via the inhibi- tion of 21-hydroxylase activity (CYP 21) (Goldman and Yawetz, 1992). Moreover, PCB126 stimulated basal
aldosterone synthesis in human adrenocortical carci- noma H295R cells with concomitant activation of the CYP11B2 gene (Li et al., 2004). In some mammals, PCBs have been found to accumulate in the adrenal gland (Berlin et al., 1975; Brandt, 1977; Biessmann, 1981; Sinjari et al., 1998), an observation which raises the possibility that PCBs can also interfere with steroi- dogenesis in the adrenal cortex, although this aspect has not been thoroughly studied.
Although PCBs are resistant to biodegradation, some congeners are known to undergo various degrees of in vivo biotransformation (James, 2001). The first step of the multiple biotransformation pathways is the introduction of oxygen via the cytochrome P450 (CYP) enzyme system, producing a hydroxylated metabolite (HO-PCB) or an epoxide. The epoxide can further rearrange to give a HO-PCB or a sulfur-contain- ing metabolite such as mercapturic-, thiol-, methylsulfi- nyl- or methylsulfonyl- (MeSO2-) PCBs. HO-PCBs are susceptible to conjugation reactions resulting in excre- tion, but a few are retained in blood as a consequence of their high affinity for the thyroid transport protein transthyretin (TTR) (Chauhan et al., 2000; Letcher et al., 2000, 2004). MeSO2-PCBs, which are more hydrophobic and resistant to further biodegradation than HO-PCBs, accumulate in lipid-containing tissues such as the liver, lung and kidney and typically repre- sent 5-20% of the total PCBs content in these tissues (Brandt and Bergman, 1987; Bergman et al., 1992, 1994; Letcher et al., 1995, 1998, 2000; Stapleton et al., 2001; Larsson et al., 2002; Sandala et al., 2004). The concentrations of total MeSO2-PCBs in tissue samples, which are mainly reported in the fat of marine mam- mals, are generally in the range of 7-800 ng/g (lipid weight) (Letcher et al., 2000). To our knowledge, there have been no reports of MeSO2-PCB residue levels in adrenal glands.
MeSO2-PCBs, like HO-PCB’s, are potential endo- crine disruptors. Exposure to MeSO2-PCBs competi- tively inhibited CYP11B1-dependent corticosterone synthesis in mouse adrenocortical Y1 cells while their parent PCBs did not (Johansson et al., 1998). Environ- mentally-relevant MeSO2-PCB concentrations have also been shown to inhibit estradiol-mediated induction of vitellogenin in primary carp hepatocytes (Letcher et al., 2002). The existence of persistent PCB metabolites in tissues, and the fact that they differ from their parent compounds in terms of physicochemical properties and
toxicity, necessitates a more comprehensive approach for evaluating the potential toxicological risk of PCB exposure to humans and wildlife.
The H295R cell line is useful for the screening of EDCs that affect adrenocortical function (reviewed by Harvey and Everett, 2003). This cell line has been char- acterized in detail and the expression of most of the key enzymes and functional proteins in the steroidogenesis pathway has been demonstrated (Gazdar et al., 1990; Staels et al., 1993; Rainey et al., 1994) (Fig. 1). These in- clude CYP11A (side-chain cleavage enzyme), CYP11B1 (11ß-hydroxylase), CYP11B2 (aldosterone synthetase), CYP17 (17a-hydroxylase/17,20 lyase), CYP19 (aroma- tase), CYP21, 3ß-HSD, 17ß-HSD (17-hydroxysteroid dehydrogenase), HMGR (3-hydroxy-3-methylglutaryl- CoA reductase), and StAR (steroidogenic acute regula- tory protein). Since sequential biotransformations in the steroidogenic pathway require tightly coordinated regulation of these enzymes, alteration in the cellular level or activity of only a single steroidogenic enzyme could result in significant consequences for adrenocorti- cal hormone production as a whole.
In order to monitor these changes at the transcrip- tional level, sensitive and specific methods have been developed in our laboratories for accurate quantification of expression of 10 steroidogenic genes in H295R cells using real-time RT-PCR (Hilscherova et al., 2004; Zhang et al., 2005). By employing this technique in the current study, mRNA levels of multiple molecular tar- gets in the steroidogenic pathway were quantified in H295R cells upon the in vitro application of four PCBs (PCB101, PCB110, PCB126 and PCB149) and five of their corresponding metabolites (3’-MeSO2-CB101, 4’- MeSO2-CB101, 4’-MeSO2-CB110, 3’-MeSO2-CB149 and 4’-MeSO2-CB149) (Fig. 2). The PCBs selected for analysis represented different structures and poten- tial mechanisms of action: one non-ortho-substituted (AhR-active) congener (PCB126); two di-ortho-substi-
HMGR
StAR
Cholesterol
CYP11A
Pregnenolone
CYP17
17a-OH-
CYP17
DHEA
3₿-HSD
Pregnenolone
.38-HSD
Progesterone
CYP17
3-HSD
17a-OH- Progesterone
CYP17 Androstene- dione
CYP21
11-Deoxycorticosterone
CYP21
17₿-HSD Testosterone CYP19
CYP11B1
Corticosterone
11-Deoxycortisol
CYP11B2
nCYP11B1
17ß-Estradiol
Aldosterone
Cortisol
Zona reticularis
Zona glomerulosa
Zona fasciculata
tuted congeners (non-AhR-active) with substitutions on the same ring (PCB110) and different rings (PCB101); and a congener with three ortho-substituted chlorines (PCB149). In addition, a concentration ratio of PCB- to-MeSO2-PCB of 5:1, which has been measured in the adipose tissues of higher mammals (Letcher et al., 2000), was used in the exposure experiments of this study. The present findings can help elucidate how PCBs and their metabolites can modulate steroidogenesis, which may have implications for human health and environmental risk assessment.
2. Materials and methods
2.1. Chemicals and culture medium
Dulbecco’s modified Eagle’s medium with Ham’s F-12 (DMEM-F12) was obtained from Sigma-Aldrich (St. Louis, MO, USA), ITS + Premix and Nu-Serum from BD Biosciences (San Jose, CA, USA), charcoal dextran-treated FBS from HyClone Laboratory Inc. (Logan, UT, USA), and dimethyl sulfoxide (DMSO; tis- sue culture grade) from Sigma-Aldrich (St. Louis, MO, USA). PCBs congeners and MeSO2-PCBs were pur- chased from AccuStandard Inc. (New Haven, CT, USA) and Cambridge Isotope Laboratories (Andover, MA, USA), respectively. IUPAC-based abbreviations for PCB and MeSO2-PCB congener structures have been recently described (Maervoet et al., 2004).
2.2. Cell culture, cytotoxicity and PCBIMeSO2-PCB treatments
Exposure of the cells to chemicals was condu- cted using a standard protocol as previously described (Zhang et al., 2005). Briefly, human adrenocortical H295R cells (ATCC, Beltsville, MD, USA) were culti- vated in DMEM-F12 supplemented with 1 ml/100 ml ITS+Premix and 2.5% BD Nu-Serum in an incubator at 37 ℃ and 5% CO2. Culture media were refreshed every two to three days.
Cytotoxicity tests were carried out on all test com- pounds. Standard solutions in DMSO were tested for cytotoxicity towards the H295R cells using a LIVE/ DEAD Viability/Cytotoxicity Kit (Invitrogen, Carls- bad, CA, USA) according to the manufacturer’s instruc- tions. Cell suspension (approximately 75000 cells in 250 ul) was added to each well of 96-Well ViewPlates™ (Packard Instruments, Meriden, CT, USA) and incu- bated at 37 ℃ and 5% CO2 for 48 h. When the cells reached 60-80% confluency, the media was changed and replaced with fresh media, and 2.5 ul of the stock standard solutions were added to each well in triplicate. Negative and solvent controls were included on all plates. No significant cytotoxicity was produced by
CI
CI
CI
SO2CH3
CI
CI
CI
CI
CI
4’-MeSO2-CB101
CI
CI
CI
CI
2,2’,4,5,5’-pentachlorobiphenyl (PCB101)
CI
CI
CI
SO2CH3
3’-MeSO2-CB101
CI
CI
CI
CI
CI
CI
CI
CI
SO2CH3
CI
2,3’,4’,5,6-pentachlorobiphenyl (PCB110)
CI
4’-MeSO2-CB110
CI
CI
CI
CI
SO2CH3
CI
CI
CI
CI
CI
CI
4’-MeSO2-CB149
CI
CI
CI
CI
CI
2,2’,4’,5,5’,6-hexachlorobiphenyl (PCB149)
CI
CI
CI
SO2CH3
3’-MeSO2-CB149
CI
CI
CI
CI
CI
3,3’,4,4’,5-pentachlorobiphenyl (PCB126)
either single PCB congeners or by PCB + 20%-corre- spondent-metabolite at 10 uM concentrations (see Sup- plemental Figure).
Before exposure to PCBs or PCBs + MeSO2-PCBs, cells were transferred to DMEM-F12 supplemented with 1 ml/100 ml ITS + Premix and 2.5% charcoal dextran- treated FBS. The concentrations of PCBs and MeSO2-
PCBs used in the exposure were 10 and 2 uM, respec- tively. Six-well tissue culture plates were used in all expo- sure experiments. Cells were dosed with 3 ml of the dosing solution according to the exposure layout. The solvent control group was treated with 3 ml 0.1% DMSO. Exposed cells were incubated for 48 h at 37 ℃ with 5% CO2.
| Gene | Sense primera | Anti-sense primera | Beaconª |
|---|---|---|---|
| CYP11A | 5'-GAGATGGCACGCAACCTGAAG-3' (1065) | 5'-CTTAGTGTCTCCTTGATGCTGGC-3' (1201) | 5'6-FAM d (CGCGATCTGCCGCGCAGCCAAGACCTCTGATCGCG) DABCYL 3' (1126) |
| CYP11B1 | 5'-GGTTTGCCAGGCTAAGC-3' (1679) | 5'-CAAACTGCCCAGAGGACAG-3' (1791) | 5'6-FAM d (CGCGATCCTGACCTTGTCCCCAGCCCCAGATCGCG) |
| DABCYL 3' (1729) | |||
| CYP11B2 | 5'-TCCAGGTGTGTTCAGTAGTTCC-3' (2705) | 5'-GAAGCCATCTCTGAGGTCTGTG-3' (2850) | 5'6-FAM d (CGCGATCCCGCAGGTTGCTTTCCCACCCTGATCGCG) DABCYL 3' (2760) |
| CYP17 | 5'-GGCACCAAGACTACAGTGATTG-3' (246) | 5'-AGAGTCAGCGAAGGCGATAC-3' (392) | 5'6-FAM d (CGCGATCAAGGGCAAGGACTTCTCTGGGCGGATCGCG) |
| DABCYL 3' (306) | |||
| CYP19 | 5'-TTGGAAATGCTGAACCCGATAC-3' (148) | 5'-GCCAGTGAGGAGCAGGAC-3' (240) | 5'6-FAM d (CGCGATCTCGTGCCTGAAGCCATGCCTGGATCGCG) DABCYL 3' (188) |
| CYP21 | 5'-ACCTCAGTTTCTCCTTTATTGC-3' (1663) | 5'-AGAGCCAGGGTCCTTCAC-3' (1756) | 5'6-FAM d (CGCGATCAGGAAGCCTTCTCTGCCAGCGAGATCGCG) DABCYL 3' (1724) |
| HMGR | 5'-TTCAGGTTCCAATGGCAACAAC-3' (1702) | 5'-GCCACGAGTCATCCCATCTG-3' (1823) | 5'6-FAM d (CGCGATCGCTGGCACCTCCACCAAGACCTAGATCGCG) DABCYL 3' (1790) |
| StAR | 5'-ATGAGTAAAGTGGTCCCAGATG-3' (451) | 5'-ACCTTGATCTCCTTGACATTGG-3' (593) | 5'6-FAM d (CGCGATCCGGCTGGAGGTCGTGGTGGACGATCGCG) DABCYL 3' (487) |
| 3ß-HSD1 | 5'-AGCATCTTCTGTTTCCTGGTG-3' (85) | 5'-TCTCCTTCAGCTCCTTCTCCTT-3' (225) | 5'6-FAM d (CGCGATCCCTCCTGCTCCTGTCACAAGGCGATCGCG) DABCYL 3' (169 for 3B-HSD1; 181 for 3B-HSD1) |
| 3B-HSD2 | 5'-AGCATCTTCTGTTTCCTGGCA-3' (96) | 5'-TCTCCTTCAGTTCCTTCTCTTC-3' (237) | |
| 17-HSD1 | 5'-TTCATGGAGAAGGTGTTGG-3' (1545) | 5'-AAGACTTGCTTGCTGTGG-3' (1648) | 5'6-FAM d (CGCGATCGACATCCACACCTTCCACCGCTGATCGCG) DABCYL 3' (1593) |
| PBGD | 5'-CTGGAGGAGTCTGGAGTCTAG-3' (866) | 5'-TGGAATGTTACGAGCAGTGATG-3' (1002) | 5'HEX d (CGCGATCACAAGAGACCATGCAGGCTACCATCGATCGCG) DABCYL 3' (903) |
a Numbers in bracket are the nucleotide positions of the primers or beacons in the Genbank gene sequences of the accession numbers, NM_000781 (CYP11A), NM_000497 (CYP11B1), NM_000498 (CYP11B2), M14564(CYP17), NM_000103(CYP19), NM_000500(CYP21), NM_000862(3B-HSD1), NM_000198(3B-HSD2), NM_000413(17ß-HSD), NM_000859 (HMGR), NM_000349 (StAR) and X04217 (PBGD).
2.3. RNA isolation and reverse transcription
Total RNA was isolated using the SV Total RNA Isolation kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Before column puri- fication, cells were rinsed twice with ice-cold 1 x PBS fol- lowed by lysis with 175 ul SV RNA lysis buffer. The lysate was then passed through a 25 gauge needle to shear genomic DNA. First-strand cDNA synthesis (from 1 µg total RNA) was performed in a 25-ul reac- tion containing 0.5 uM Oligo(dT)17, 1 x first-strand syn- thesis buffer, 0.5 mM dNTP mix (Amersham Pharmacia Biotech, Piscataway, NJ, USA), 2 U/ul RNaseOUT (Invitrogen, Carlsbad, CA, USA) and 12.5 U/ul N-MLV RT (H-) reverse transcriptase. The reaction was incubated at 42 ℃ for 50 min and, on completion, was inactivated at 70 ℃ for 15 min. To digest RNA, 1.25 ul RNase H (Invitrogen) was added and incubated at 37 ℃ for 30 min. Finally, cDNA was purified using the Wizard SV Gel and PCR Clean-Up System (Promega) according to the manufacturer’s protocol.
2.4. Quantitative real-time RT-PCR
The design of gene-specific primers and molecular beacons was based on work by Zhang et al. (2005). The sequences for these primers and probes are shown in Table 1. Real-time (quantitative) RT-PCR was per- formed using an iCycler system (Bio-Rad Laboratories, Hercules, CA, USA) in sterile 96-well PCR plates (Bio- Rad Laboratories). PCR reaction mixtures contained 1 × PCR buffer II (Applied Biosystems, Foster City, CA, USA), 200 µM dNTP mix (Promega), 5.5 mM MgCl2 (Applied Biosystems), 200 nM molecular beacon, 0.05 U/ul DNA polymerase AmpliTaq Gold (Applied Biosystems), 200 nM or 400 nM sense and anti-sense primers. Genes used with a primer concentration of 200 nM were: StAR, CYP19, 30-HSD1, CYP11B1 and 17ß-HSD1; genes used with a primer concentration of 400 nM were: CYP17, CYP11A, HMGR, CYP21, CYP11B2 and 3ß-HSD2. The housekeeping gene prophobilinogen deaminase (PBGD) was used as a ref- erence gene to normalize target gene expression; a PBGD-specific primer was used at a concentration of 200 nM. A final reaction volume of 20 ul was made up with 10 ul diluted cDNA and nuclease-free distilled water (Invitrogen). The PCR reaction mix was dena- tured at 95 ℃ for 10 min before the first PCR cycle. The thermal cycle profile was (1) denaturing for 15 s at 95 ℃; (2) annealing for 30 s at 60 ℃ (all genes except 17ß-HSD at 58 ℃); (3) extension for 30 s at 72 °C. A total of 50 PCR cycles were used. For each sample, at least triplicate amplifications were per- formed and the average of all measurements was used in data analysis. The cycle at which the abundance of the accumulated PCR product crosses a specific thresh-
old, the threshold cycle (CT), was determined for each reaction.
2.5. Calculation of relative gene expression levels
For each experimental sample, the expression level of a target gene was normalized to PBGD, resulting in a mean normalized expression (MNE) value as derived from Eq. (1):
Ereference CT (1)
MNE = (Etarget)“T
reference,mean
target,mean
where Etarget and Ereference (=10-1/slope) represent the PCR efficiencies determined from the slopes of the standard curves constructed using gene-specific RNA standards of known copy number (Simon, 2003). Final data were calculated as mean normalized steroidogenic gene expres- sion relative to the solvent control, and expressed as:
N-fold change = MNEexp/MNEcon (2)
2.6. Statistical analysis
Statistical analyses of gene expression profiles were performed using SigmaStat 3.0.1 (SYSTAT Software Inc., CA, USA). Differences in gene expression were evaluated by ANOVA followed by Tukey’s test. Differ- ences with p <0.05 were considered to be statistically significant.
3. Results
3.1. Effects of PCBs on cytochrome P450 enzyme-related gene expression
Expression profiles of CYP11A, CYP11B1, CYP- 11B2, CYP17, CYP19 and CYP21 varied in response to the four selected PCBs and three co-treatments with MeSO2 metabolites (Fig. 3). For the purposes of this study, a >25% change in mRNA abundance was consid- ered biologically relevant. CYP11A mRNA expression did not differ appreciably under any of the exposure conditions, whereas induction of CYP17, CYP11B1, CYP11B2, CYP19 and CYP21 varied between the differ- ent PCB congener treatments.
CYP17 expression induced by PCB110 was signifi- cantly reduced by co-exposure to the congener and its MeSO2 metabolite, but none of the other congeners or metabolites had a relevant effect on gene expression (Fig. 3). Exposure to PCB110, PCB149, PCB126 and PCB101 up-regulated CYP11B1 expression by 3.4-, 2.9-, 1.9- and 1.6-fold, respectively. Co-treatment with 3’- and 4’-MeSO2-CB149 resulted in a significant 1.8- fold decrease of CYP11B1 induction caused by exposure
Relative mRNA expression
0
Relative mRNA expression
B
Relative mRNA expression
A
0
10
15
20
25
30
35
-
0.5
1.5
2.5
3.5
0.2
0.4
0.6
0.8
1.2
1.4
1.6
5
1
2
3
4
0
1
DMSO
DMSO
T
DMSO
T
PCB126
**
PCB126
++ e
PCB126
T
PCB 101
CYP1182
PCB 101
CYP11B1
CYP11A
+
A
+
PCB 101
T
*
PCB101 + M
PCB101 + M
#
+
T +
PCB101 + M
A
++
PCB110
T
PCB110
+
PCB110
T
+
#
PCB110 + M
#
PCB110 + M
PCB110 + M
T
PCB149
of
PCB149
8
*
PCB149
C **
PCB149 + M **
PCB149 + M
#
+
PCB149 + M
T
Relative mRNA expression
TI
Relative mRNA expression
E
Relative mRNA expression
D
0.5
1.5
2
2.5
-
-
2
+
EN
9
0.2
0.4
0.6
0.8
1.2
1.6
-
-
C
1.4
1
DMSO
DMSO
DMSO
T
PCB126
PCB126
+
C st
PCB126
F
*
PCB 101
1+
CYP21
PCB 101
4 **
CYP19
PCB 101
7
CYP17
PCB101 + M
**
PCB101 + M
++
PCB101 + M
T
PCB110
+
PCB110
++
PCB110
T
+
#
PCB110 + M
*
PCB110 + M
++
PCB110 + M
Y
PCB149
++
PCB149
++
PCB149
PCB149 + M
H
PCB149 + M
K +
PCB149 + M
T
cytochrome CYP 450 genes, (A) CYP11A, (B) CYP11B1, (C) CYP11B2, (D) CYP17, (E) CYP19 and (F) CYP21, in H259R cells. Relative abundance of mRNA represents the fold-change in expression with respect to the DMSO solvent control (=1.0). Values presented are the means of three replicate measurements. * p < 0.05, statistically different from the DMSO vehicle control; # p < 0.05, statistical difference between the parent compound and co-exposure with its metabolite(s).
to PCB149 alone (p < 0.05). Likewise, co-treatment with 3’- and 4’-MeSO2-CB101 significantly up-regulated CYP11B1 by 1.6-fold above the induction caused by PCB101 alone (p <0.05). In contrast, co-exposure to PCB110 and its MeSO2 metabolite significantly reduced the up-regulation produced by exposure to PCB110 alone (p <0.05).
CYP11B2 showed the greatest PCB-induced activa- tion among all steroidogenic genes examined. PCB110, PCB126, PCB149 and PCB101 elevated CYP11B2 mRNA expression by 29.9-, 5.8-, 4.0- and 3.4-fold, respectively. Co-treatment with 4’-MeSO2-CB110 re- sulted in a 1.5-fold decrease in the expression caused by exposure to PCB110 alone. None of the other
congeners or metabolites differed significantly from one another in terms of CYP11B2 gene expression.
The PCB-induced expression pattern of CYP19 was fairly similar to that of CYP11B1. CYP19 transcription was increased by PCB110, PCB149, PCB101 and PCB126 by 5.5-, 4.0-, 3.0- and 2.4-fold, respectively. The effect of MeSO2 metabolites on PCB-induced ex- pression of CYP19 was minimal.
CYP21 expression was least affected by PCBs when compared to the other three PCB-responsive genes; mRNA levels were elevated by 1.8-, 1.5- and 1.4-fold by PCB110, PCB149 and PCB101, respectively. Co- treatment with MeSO2-PCBs did not significantly alter PCB-induced expression of CYP21.
3.2. Effects of PCBs on hydroxysteroid dehydrogenase gene expression
The mRNA expression profiles of the dehydrogenase genes involved in steroidogenesis, 36-HSD1, 3ß-HSD2 and 17ß-HSD1, varied among both PCBs and co-treat- ments with MeSO2 metabolites (Fig. 4). 30-HSD1 mRNA levels in cells exposed to PCB149 and PCB101
were increased by 3.7- and 1.7-fold, respectively. When exposed jointly to 3’- and 4’-MeSO2-CB149, the stimu- latory effect of PCB149 was completely eliminated, bringing 3ß-HSD1 mRNA expression to the basal level. 3ß-HSD2, an isogene of 3ß-HSD1, was up-regulated by all four tested PCBs. PCB110 increased 30-HSD2 mRNA level by 6.2-fold while PCB149, PCB101 and PCB126 had lesser effects, increasing gene expression by 2.5-, 2.1- and 1.5-fold, respectively. In addition, co-exposure to PCB149 and its metabolites significantly reduced the up-regulation in expression observed with exposure to PCB149 alone (p < 0.05). 17ß-HSD1 expres- sion was increased by PCB149 by 2.8-fold, but a 5.0-fold decrease in expression was observed when 3’- and 4’- MeSO2-CB149 were co-applied to H295R cells.
3.3. Effects of PCBs on StAR and HMGR gene expression
StAR and HMGR expression responded differently to the selected PCBs and co-treatment with their MeSO2 metabolites (Fig. 5). StAR mRNA levels were decreased by 2.1-fold upon exposure to PCB110. Co-exposure to
A
38-HSD1
B
38-HSD2
Relative mRNA abundance
4.5
#
Relative mRNA abundance
7
4
1
H++
H +
3.5
-
3
5
2.5
4
#:
2
馨
w
++
1.5
1++
T
++
**
+
1
T
T
2
+++
=
0.5
-
0
DMSO
PCB126
PCB 101
PCB101 + M
PCB110
PCB110 + M
PCB149
PCB149 + M
.
DMSO
PCB126
PCB 101
PCB101 + M
PCB110
PCB110 + M
PCB149
PCB149 + M
0
178-HSD1
Relative mRNA abundance
3.5
#
3
+
2.5
2
1.5
T
1
T
++
0.5
T
y
0
DMSO
PCB126
PCB 101
PCB101 + M
PCB110
PCB110 + M
PCB149
PCB149 + M
A
B
STAR
HMGR
Relative mRNA abundance
1.6
Relative mRNA abundance
1.6
1.4
1.4
1.2
T
T
#
T
1.2
T
T
1
T
1
T
T
0.8
4
T
0.8
T
H +
0.6
0.6
0.4
0.4
0.2
0.2
0
DMSO
PCB126
PCB 101
PCB101 + M
PCB110
PCB110 + M
PCB149
PCB149 + M
0
DMSO
PCB126
PCB 101
PCB101 + M
PCB110
PCB110 + M
PCB149
PCB149 + M
4’-MeSO2-CB110 reduced the inhibitory effect of PCB110 on StAR expression by 1.7-fold. Transcription of HMGR mRNA was not significantly altered by expo- sure to any of the individual compounds or mixtures.
3.4. Genes affected by PCB110 and PCB149
The results indicate that, compared to the other PCB congeners tested, PCB110 and PCB149 caused the stron- gest stimulatory effects on the expression of the steroido- genic genes examined in this study. The enzyme-related genes that were affected by PCB110 were CYP11B2, 3B-HSD2 and CYP19, and those affected by PCB149 were 3ß-HSD1 and 17ß-HSD1.
4. Discussion
Current assessments of the endocrine disrupting properties of chemicals are largely based on the potential for direct interaction of chemicals with hormone recep- tors such as the estrogen receptor (ER), androgen recep- tor (AR) and thyroid hormone receptor (ThR). Of particular concern are those compounds that mimic endogenous estrogens, sometimes called xenoestrogens, which are direct-acting estrogen agonists or antagonists that cause effects by binding to the ER. However, there are several other mechanisms of endocrine disruption (Sanderson et al., 1999, 2000, 2001; Hilscherova et al., 2004), including a number of non-receptor mediated processes that may alter endocrine function, emphasiz- ing the inadequacy of purely receptor-based screening strategies for endocrine disruptors. These effects are often exerted indirectly via effects on common signal transduction pathways, or by acting as direct or indirect stimulators or inhibitors of the enzymes involved in the
production, transformation or elimination of steroid hormones (reviewed by Baker, 2001).
The adrenal cortex is often regarded as the most com- mon target for toxicity in the endocrine system (Ribelin, 1984; Colby, 1994) because of (1) the rich blood supply to this small organ, (2) its high lipid content which facil- itates the accumulation of lipophilic compounds, and (3) its capacity to synthesize all major classes of steroids (androgens, estrogens, progesterone, as well as glucocor- ticoids and mineralocorticoids). Despite the importance of adrenocortical function and steroidogenesis to human health, characterizations of the effects of chemicals on adrenocortical function or the molecular pathways of steroidogenesis (other than limited aromatase activity) are surprisingly omitted in current risk assessment programmes.
The H295R cell line is a useful in vitro screening sys- tem for both adrenocortical toxicity and alteration in steroidogenesis through the assessment of cortisol pro- duction and most of the major enzymes and functional proteins in the steroidogenic pathway (Sanderson et al., 1999). In this study, we demonstrated the effects of four PCBs containing five to six chlorine substituents (PCB126, PCB149, PCB110 and PCB101) and the co- administration of their methylsulfonyl metabolites (ex- cept that of PCB126) on the regulation of mRNA expression of 11 steroidogenic genes (six genes encod- ing cytochrome P450 enzymes: CYP11A, CYP11B1, CYP11B2, CYP17, CYP19 and CYP21; three genes encoding hydroxysteroid dehydrogenases: 3ß-HSD1, 36-HSD2 and 17ß-HSD1; two genes involved in choles- terol biosynthesis and transport: HMGR and StAR). With the exception of a recent study on PCB126 by Li et al. (2004), the toxicities of the other three PCBs have not been characterized previously in terms of their abil- ities to alter steroidogenic gene expression. These four
PCBs were selected because of their high hydrophobicity and tendency to accumulate in lipid-bearing tissues (Let- cher et al., 1998, 2000) and the fact that they are fre- quently found in tissues of wildlife and humans (Wiberg et al., 1998; Letcher et al., 2000; Sandala et al., 2004). To our knowledge, this study is also the first attempt to elucidate the combined effects of PCBs and MeSO2-PCBs on adrenocortical steroidogenesis.
With the exception of CYP11A and CYP17, the examined cytochrome P450 genes (CYP11B1, CYP11B2, CYP19 and CYP21) were up-regulated to different de- grees by the tested PCBs. CYP11A catalyzes side-chain cleavage of cholesterol, which is the starting point of ste- roid synthesis whereas CYP17 controls the initial steps of cortisol biosynthesis by catalyzing the 17a-hydroxyl- ation of pregnenolone (or progesterone) to 17x-hydroxy- pregnenolone (or 17a-hydroxyprogesterone). Therefore, although CYP11A and CYP17 were not highly induced by exposure to PCBs and their MeSO2 metabolites in this study, it is possible that small changes in their expression may have large effects on steroidogenesis be- cause of the positions that they occupy in the pathway. The marked up-regulation of CYP11B1, CYP11B2 and CYP19 may indicate that the tested PCBs affect the final steps in steroid synthesis.
In the zona glomerulosa, CYP11B2 is responsible for the rate-limiting steps in aldosterone production, involv- ing 11ß-hydroxylation of 11-deoxycorticosterone to cor- ticosterone and its subsequent 18-hydroxylation and 18-oxidation. Since aldosterone production is largely controlled by transcription of CYP11B2 (Bassett et al., 2004), increased expression of CYP11B2 should lead to an excess of aldosterone. Elevated aldosterone levels are associated with hypertension, which can cause signif- icant tissue damage to the central nervous system, heart and kidney (Brilla and Weber, 1992; Strandgaard and Paulson, 1994). In this study, the greatest transcriptional activation of CYP11B2 (29.9-fold) was caused by expo- sure to PCB110, which suggests that this PCB congener may have toxic effects through increased aldosterone synthesis. Although aldosterone levels in the culture medium were not measured in the current study, the cor- relation between mRNA expression of CYP11B2 and aldosterone production in H295R cells was recently determined by Li et al. (2004), who demonstrated that a 3.3-fold induction of aldosterone by 10 µM PCB126 occurred concomitantly with a 5.1-fold increase in CYP11B2 mRNA expression. Exposure of H295R cells to the same dose of PCB126 in the current study produced a similar magnitude of mRNA induction (5.8-fold), indicating high between-laboratory reproduc- ibility of the H295R bioassay and the real-time RT-PCR technique.
In the zona fasciculata, the final step in the biosyn- thesis of the glucocorticoid cortisol from 11-deoxycorti- sol is catalyzed by mitochondrial CYP11B1. Cortisol
has numerous metabolic, developmental, immunosup- pressive, anti-inflammatory and other functions in the body, including regulating the catabolismof carbohy- drates, proteins and lipids. The results of the present study suggest that the four tested PCBs activated CYP11B1 mRNA expression by 1.6-3.4-fold, demon- strating their potential to interfere with the glucocorti- coid synthesis pathway in vitro. Again, the strongest transcriptional response resulted from PCB110 treat- ment.
CYP19 is a crucial steroidogenic enzyme which catalyzes the rate-limiting step in the conversion of androgens to estrogens and its altered expression is a commonly used molecular biomarker of endocrine dis- ruption. In this study, PCB exposure stimulated CYP19 expression in H295R cells by 2.4-5.5-fold. An aryl hydrocarbon-responsive element (AhR/ARNT), which is often associated with exposures to polycyclic aromatic hydrocarbons, has been reported in the zebra- fish (Danio rerio) CYP19A1 promoter region (Tong and Chung, 2003), which suggests that PCBs may also dis- rupt endocrine function by directly regulating CYP19 transcription.
PCB-induced CYP19 expression was not altered by the co-administration of MeSO2-PCBs. MeSO2 metabo- lites are known to be antiestrogenic, and are thought to act by competing with 17ß-estradiol for binding sites on the ER (Letcher et al., 2002). The results of this study support a receptor-based, rather than aromatase-based, mechanism of action for MeSO2-PCBs. However, other non-transcriptional regulation of CYP19 by PCB meta- bolites should not be ignored. A recent study showed that a 24-h exposure to four MeSO2-PCBs, including 4’-MeSO2-CB149, could result in a concentration- dependent decrease of aromatase activity in H295R cells (Heneweer et al., 2004). Therefore, additional studies are required for the comprehensive characterization of the potential effects of PCBs and their metabolites on aro- matase function.
3-HSD is responsible for the oxidation and isomer- ization of 5-ene-3ß-hydroxy steroids to the correspond- ing 4-ene-3-ketosteroids, an obligate step in the biosynthesis not only of androgens and estrogens but also of mineralocorticoids and glucocorticoids. In hu- mans, two closely related types of 3ß-HSD (36-HSD1 and 3ß-HSD2) have been identified and their genes en- code deduced proteins of 371 and 372 amino acids, respectively (Luu-The et al., 1989; Rhéaume et al., 1991). 36-HSD1 is highly expressed in the syncytial tro- phoblast and in sebaceous glands, and 3ß-HSD2 is exclusively expressed in the adrenal cortex and gonads (reviewed by Mason et al., 1997). In vitro kinetic studies have suggested that the catalytic efficiency of 30-HSD1 with regard to 45-steroid substrates is several times greater than that of 30-HSD2 (Rhéaume et al., 1991). To date, the activity of 3ß-HSD1 in human adrenal
glands is unknown (Pang et al., 2003). The results of the present study suggest that the expression patterns of the two isogenes due to PCB exposure are different. Signi- ficantly greater expression (>2-fold) of 3ß-HSD1 was observed only after exposure to PCB149 whereas com- parable up-regulation of 3-HSD2 was caused by PCB149, PCB110 and PCB101. Differential expression of these two isogenes as a result of PCB exposure sug- gests that they may be regulated differently and have dis- tinct functional roles in steroidogenesis.
17ß-HSD plays a critical role in the regulation of ste- roid hormones, such as estrogens and androgens, by cat- alyzing the reduction of 17-ketosteroids or the oxidation of 17ß-hydroxysteroids using NAD(P)H or NAD(P)+ as a cofactor. Its involvement in the final step of sex steroid biosynthesis means that the activity of 17B-HSD controls estrogen and androgen concentrations (Darney et al., 1996). In the present study, 17ß-HSD1 in H295R cells was up-regulated 2.8-fold by PCB149. This conge- ner also up-regulated 3ß-HSD1 (3.7-fold), 3ß-HSD2 (2.5-fold) and CYP19 (4.0-fold) by comparable amounts. This concomitant increase in the expression of a sequence of genes that function in estrogen biosyn- thesis may lead to elevated estrogen production.
StAR transports cholesterol across the mitochondrial membrane for conversion to pregnenolone by CYP11A. Thus, StAR represents an important rate-limiting step in steroidogenesis. StAR mRNA expression was shown to be marginally suppressed by several PCBs used in this study. However, decreased StAR transcription does not necessarily result in reduced cholesterol transport. Recently, work by Sugawara and Fujimoto (2004) dem- onstrated that the action of StAR is regulated at the translational level and affected by the protein’s life-span due to cholesterol-binding, but is not modified by the transcriptional level of StAR. Cholesterol supply to the steroidogenic pathway is critically regulated by the action of HMGR, which controls the rate-limiting step in cholesterol biosynthesis. This study showed that the level of HMGR transcription in H295R cells remained relatively unchanged in response to all PCB treatments, as did CYP11A and CYP17. However, as described above, small changes in these enzyme levels may result in large changes in the steroidogenic pathway. Further research is therefore needed to determine the effects of small-scale changes in gene expression in the early stages of steroidogenesis. Nevertheless, the results of this study indicate that the genes that are most affected by PCBs are likely to be those involved in the final steps of steroid hormone production (e.g. CYP11B2, CYP11B1 and CYP19).
PCB126 was the only congener tested in this study with a co-planar “dioxin-like” structure. As described previously, PCBs with high AhR affinity are known to have antiestrogenic activity through cross-talk with the ER (Safe et al., 1998). In the current study, exposure
to PCB126 had no effect on CYP11A, CYP21, 3ß- SHD1, 17ß-HSD1, StAR or HMGR expression, had a moderate effect on CYP17, CYP19 and 30-HSD2, and up-regulated CYP11B2 expression by more than 5-fold. These results are largely in agreement with those of a re- cent study of H295R exposure to PCB126 (Li and Wang, 2005) with the exception of CYP17, which was moderately up-regulated in the current study, but was found to be significantly down-regulated by Li and Wang (2005). The reasons for this disparity are un- known. It is interesting to note that both CYP11A and CYP21 expression was induced by all the other PCB congeners and by some of the metabolites tested, but were unaffected by PCB126. These results support the assertion that PCB126 does not affect steroidogenesis through the AhR (Li and Wang, 2005).
The results of the current study demonstrate that some MeSO2-PCB metabolites can modify the effects of their parent PCBs on the stimulation of steroidogenic gene expression. Generally, co-exposure to the parent compound and its MeSO2 metabolite(s) had an antago- nistic effect on the activity of the parent compound. For instance, exposure to 3’- and 4’-MeSO2-CB149 re- sulted in 3.4- and 5.0-fold decreases in PCB149-induced expression of 3ß-HSD1 and 17ß-HSD1 expression, respectively. This observation indicates that the methyl- sulfone group may play a role in the inhibition of steroi- dogenic gene expression. Although the mechanism accounting for this gene inhibition is unclear presently, MeSO2-PCBs have been recently shown to exhibit antiestrogenic activity by competing with E2 for binding to estrogen receptor a (Letcher et al., 2002). This opens up the possibility that MeSO2-PCB antiestrogenicity might increase the unbound level of E2 in vivo, which might in turn attenuate steroidogenesis by feedback inhibition mediated via the suppression of steroidogenic gene expression. However, the effects of whole organism exposure to MeSO2-PCBs are currently unknown.
In summary, PCBs have the potential to cause endo- crine disruption, in part by affecting the transcriptional machinery of the steroidogenic genes involved in the final steps of steroid production and, in turn potentially affecting the balance of hormone levels. The antagonistic effect of MeSO2-PCBs on PCB-induced expression of some steroidogenic genes suggests that some PCBs and their metabolites might have opposing effects on steroid hormone biosynthesis. Our findings provide further evi- dence that the H295R cell line is a useful in vitro model for screening and mechanistic studies of the toxic effects of environmental chemicals on steroidogenesis.
Acknowledgements
The authors would like to thank Dr. Robert J. Let- cher for his critical review of the manuscript. The work
described in this paper was supported by a Central Allo- cation Grant (Project No. 8730011) from the Research Grants Council of Hong Kong and a research grant (Project No. 7001539) from City University of Hong Kong.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.chemosphere.2005.08.013.
References
Andric, S.A., Kostic, T.S., Dragisic, S.M., Stojilkovic, S.S., Kovacevic, R.Z., 2001. Acute in vivo and in vitro effects of Aroclors on rat testicular steroidogenesis. In: Robertson, L.W., Hansen, L.G. (Eds.), PCBs: Recent Advances in the Environmental Toxicology and Health Effects. University Press of Kentucky, Lexington, USA, pp. 303-308.
Baker, V.A., 2001. Endocrine disrupters-testing strategies to assess human hazard. Toxicol. In vitro 15, 413-419.
Bassett, M.H., White, P.C., Rainey, W.E., 2004. The regulation of aldosterone synthase expression. Mol. Cell Endocrinol. 217, 67-74.
Bergman, Å., Athanasiadou, M., Bergek, S., Haraguchi, K., Jensen, S., Wehler, E.K., 1992. PCB and PCB methyl sulfones in mink treated with PCB and various PCB fractions. Ambio 21, 570-576.
Bergman, Å., Norstrom, R.J., Haraguchi, K., Kuroki, H., Béland, P., 1994. PCB and DDE methyl sulfones in mammals from Canada and Sweden. Environ. Toxicol. Chem. 13, 121-128.
Berlin, M., Gage, J., Holm, S., 1975. Distribution and metabolism of 2,4,5,2’,5’-pentachlorobiphenyl. Arch. Envi- ron. Health 30, 141-147.
Biessmann, A., 1981. Accumulation of polychlorinated biphe- nyls in steroidogenic tissue of gonads and adrenals in Japanese Quail. Arch. Environ. Contam. Toxicol. 10, 653- 662.
Brandt, I., 1977. Tissue localization of polychlorinated biphe- nyls-chemical structure related to pattern of distribution. Acta Pharmacol. Toxicol. 40, 1-108.
Brandt, I., Bergman, Å., 1987. PCB methyl sulfones and related compounds: identification of target cells and tissues in different species. Chemosphere 16, 1671-1676.
Brilla, C.G., Weber, K.T., 1992. Mineralocorticoid excess, dietary sodium, and myocardial fibrosis. J. Lab. Clin. Med. 120, 893-901.
Chauhan, K.R., Kodavanti, P.R., Mckinney, J.D., 2000. Assessing the role of ortho-substitution on polychlorinated biphenyl binding to transthyretin, a thyroxine transport protein. Toxicol. Appl. Pharmacol. 162, 10-21.
Colby, H.D., 1994. In vitro assessment of adrenocortical toxicity. J. Pharmacol. Toxicol. Methods 32, 1-6.
Darney, K.J., Zirkin, B.R., Ewing, L.L., 1996. Testosterone autoregulation of its biosynthesis in the rat testis: inhibition of 17a-hydroxylase activity. J. Androl. 17, 137-142.
Foster, W.G., 1995. The reproductive toxicology of great lakes contaminants. Environ. Health Perspect. 103 (Suppl. 9), 63- 69.
Fukuzawa, N.H., Ohsako, S., Nagano, R., Sakaue, M., Baba, T., Aoki, Y., Tohyama, C., 2003. Effects of 3,3’,4,4’,5- pentachlorobiphenyl, a coplanar polychlorinated biphenyl congener, on cultured neonatal mouse testis. Toxicol. In vitro 17, 259-269.
Gazdar, A.F., Oie, H.K., Shackleton, C.H., Chen, T.R., Triche, T.J., Myers, C.E., Chrousos, G.P., Brennan, M.F., Stein, C.A., La Rocca, R.V., 1990. Establishment and character- ization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50, 5488-5496.
Giesy, J.P., Kannan, K., 1998. Dioxin-like and non-dioxin-like toxic effects of polychlorinated biphenyls (PCBs): implica- tions for risk assessment. Crit. Rev. Toxicol. 28, 511-569. Goldman, D., Yawetz, A., 1992. The interference of polychlo- rinated biphenyls (Aroclor 1254) with membrane regulation of the activities of cytochromes P-450C21 and P-450(17) alpha, lyase in guinea-pig adrenal microsomes. J. Steroid Biochem. Mol. Biol. 42, 37-47.
Gregoraszczuk, E.L., Wojtowicz, A.K., 2002. In vitro exposure of porcine ovarian follicular cells to PCB 153 alters steroid secretion but not their viability-preliminary study. Scien- tific World Journal 2, 261-267.
Harvey, P.W., Everett, D.J., 2003. The adrenal cortex and steroidogenesis as cellular and molecular targets for toxicity: critical omissions from regulatory endocrine disrupter screening strategies for human health? J. Appl. Toxicol. 23, 81-87.
Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X., Sanderson, J.T, Yu, R.M.K., Wu, R.S.S., Giesy, J.P., 2004. Assessment of the effects of chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol. Sci. 81, 78-89.
James, M.O., 2001. Polychlorinated biphenyls: metabolism and metabolites. In: Robertson, L.W., Hansen, L.G. (Eds.), PCBs: Recent Advances in the Environmental Toxicology and Health Effects. University Press of Kentucky, Lexing- ton, USA, pp. 35-46.
Johansson, M., Larsson, C., Bergman, A., Lund, B.O., 1998. Structure-activity relationship for inhibition of CYP11B1- dependent glucocorticoid synthesis in Y1 cells by aryl methyl sulfones. Pharmacol. Toxicol. 83, 225-230.
Larsson, C., Ellerichmann, T., Hühnerfuss, H., Bergman, Å., 2002. Chiral PCB methyl sulfones in rat tissues after exposure to technical PCBs. Environ. Sci. Technol. 36, 2833-2838.
Letcher, R.J., Norstrom, R.J., Bergman, Å., 1995. Geograph- ical distribution and identification of methyl sulfone PCB and DDE metabolites in pooled polar bear (Ursus mariti- mus) adipose tissue from western hemisphere arctic and sub- arctic regions. Sci. Total Environ. 160-161, 409-420.
Letcher, R.J., Norstrom, R.J., Muir, D.C.G., 1998. Biotrans- formation versus bioaccumulation: sources of methyl sul- fone PCB and 4,4’-DDE metabolites in the polar bear food chain. Environ. Sci. Technol. 32, 1656-1661.
Letcher, R.J., Klasson-Wehler, E., Bergman, Å., 2000. Methyl sulfone and hydroxylated metabolites of polychlorinated biphenyls. In: Paasivirta, J. (Ed.), The Handbook of
Environmental Chemistry: New Types of Persistent Halo- genated Compounds, vol. 3. Springer-Verlag, Berlin, pp. 315-359, and references therein.
Letcher, R.J., Lemmen, J.G., van der Burg, B., Brouwer, A., Bergman, A., Giesy, J.P., van den Berg, M., 2002. In vitro antiestrogenic effects of aryl methyl sulfone metabolites of polychlorinated biphenyls and 2,2-bis(4-chlorophenyl)-1,1- dichloroethene on 17-estradiol-induced gene expression in several bioassay systems. Toxicol. Sci. 69, 362-372.
Letcher, R.J., Chu, S.G., Li, H., 2004. Determination of hydroxylated polychlorinated biphenyls (HO-PCBs) in plasma by high performance liquid chromatography-elec- trospray-tandem quadrapole mass spectrometry. J. Anal. Toxicol. 29, 209-216.
Li, L .- A., Wang, P .- W., 2005. PCB126 induces differential changes in androgen, cortisol, and aldosterone biosynthesis in human adrenocortical H295R cells. Toxicol. Sci. 85, 530- 540.
Li, L .- A., Wang, P .- W., Chang, L.W., 2004. Polychlorinated biphenyl 126 stimulates basal and inducible aldosterone biosynthesis of human adrenocortical H295R cells. Toxicol. App. Pharmacol. 195, 92-102.
Luu-The, V., Lachance, Y., Labrie, C., Leblanc, G., Thomas, J.L., Strickler, R.C., Labrie, F., 1989. Full length cDNA structure and deduced amino acid sequence of human 3ß- hydroxy-5-ene steroid dehydrogenase. Mol. Endocrinol. 3, 1310-1312.
Maervoet, J., Covaci, A., Schepens, P., Sandau, C.D., Letcher, R.J., 2004. A reassessment of the nomenclature of poly- chlorinated biphenyl (PCB) metabolites. Environ. Health Perspect. 112, 291-294.
Mason, J.I., Keeney, D.S., Bird, I.M., Rainey, W.E., Moroh- ashi, K., Leers-Sucheta, S., Melner, M.H., 1997. The regulation of 3ß-hydroxysteroid dehydrogenase expression. Steroids 62, 164-168.
Pang, S., Carbunaru, G., Haider, A., Copeland, K.C., Chang, Y.T., Lutfallah, C., Mason, J.I., 2003. Carriers for type II 3ß-hydroxysteroid dehydrogenase (HSD3฿2) deficiency can only be identified by HSD3B2 genotype study and not by hormone test. Clin. Endocrinol. (Oxf). 58, 323-331.
Rainey, W.E., Bird, I.M., Mason, J.I., 1994. The NCI-H295 cell line: a pluripotent model for human adrenocortical studies. Mol. Cell. Endocrinol. 100, 45-50.
Rhéaume, E., Lachance, Y., Zhao, H.F., Breton, N., Dumont, M., de Launoit, Y., Trudel, C., Luu-The, V., Simard, J., Labrie, F., 1991. Structure and expression of a new complementary DNA encoding the almost exclusive 3ß- hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase in human adrenals and gonads. Mol. Endocrinol. 5, 1147- 1157.
Ribelin, W.E., 1984. The effects of drugs and chemicals upon the structure of the adrenal gland. Fundam. Appl. Toxicol. 4, 105-119.
Safe, S., Wang, F., Porter, W., Duan, R., McDougal, A., 1998. Ah receptor agonists as endocrine disrupters: antiestrogenic activity and mechanisms. Toxicol. Lett. 102-103, 343-347. Sandala, G.M., Sonne-Hansen, C., Dietz, R., Muir, D.C.G., Valters, K., Bennett, E.R., Born, E.W., Letcher, R.J., 2004. Hydroxylated and methyl sulfone PCB metabolites in adipose and whole blood of polar bear (Ursus maritimus) from East Greenland. Sci. Total Environ. 331, 125-141.
Sanderson, J.T., Heneweer, M., Seinen, W., Giesy, J.P., van den Berg, M., 1999. Chloro-s-triazine herbicides and certain metabolites induce aromatase (CYP19) activity in H295R human adrenocortical carcinoma cells. Organohalogen Compd. 42, 5-8.
Sanderson, J.T., Seinen, W., Giesy, J.P., van den Berg, M., 2000. 2-chloro-s-triazine herbicides induce aromatase (CYP- 19) activity in H295R human adrenocortical carcinoma cells: a novel mechanism for estrogenicity. Toxicol. Sci. 54, 121-127.
Sanderson, J.T., Thomas, J., Letcher, R.J., Heneweer, M., Giesy, J.P., Van den Berg, M., 2001. Effects of chloro-s- triazine herbicides and metabolites on aromatase (CYP19) activity in various human cell lines and on vitellogenin production in male carp hepatocytes. Environ. Health Perspect. 109, 1027-1031.
Simon, P., 2003. Q-Gene: processing quantitative real-time RT- PCR data. Bioinformatics 19, 1439-1440.
Sinjari, T., Wehler, K., Hovander, L., Darnerud, P.O., 1998. Hydroxylated polychlorinated biphenyls: distribution in the pregnant mouse. Xenobiotica 28, 31-40.
Staels, B., Hum, D.W., Miller, W.L., 1993. Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol. Endocrinol. 7, 423-433.
Stapleton, H.M., Letcher, R.J., Baker, J.E., 2001. Metabolism of PCBs by the deepwater sculpin (Myoxocephalus thomp- soni). Environ. Sci. Technol. 35, 4747-4752.
Strandgaard, S., Paulson, O.B., 1994. Hypertension and human cerebrovascular disease. In: Swales, J.D. (Ed.), Textbook of Hypertension. Blackwell Scientific Publications, Oxford, pp. 690-697.
Sugawara, T., Fujimoto, S., 2004. The potential function of steroid sulphatase activity in steroid production and steroi- dogenic acute regulatory protein expression. Biochem. J. 380, 153-160.
Tong, S.K., Chung, B.C., 2003. Analysis of zebrafish cyp19 promoters. J. Steroid Biochem. Mol. Biol. 86, 381- 386.
Ulrich, B., Stahlmann, R., 2004. Developmental toxicity of polychlorinated biphenyls (PCBs): a systematic review of experimental data. Arch. Toxicol. 78, 252-268.
van den Berg, M., Birnbaum, M.L., Bosveld, B.T.C., Brum- ström, B., Cook, P., Feely, M., Giesy, J.P., Hanberg, A., Hasegawa, R., Kennedy, S.W., Kubiak, T., Larsen, J.C., van Leeuwen, F.X.R., Djien Liem, A.K., Nolt, C., Peterson, R.E., Pollinger, L., Safe, S., Schrenk, D., Tillitt, D., Tusklind, M., Younes, M., Waren, F., Zacharewski, T., 1998. Toxic equivalency factors (TEFs) for PCBs, PCDDs, PCDFs for humans and wildlife. Environ. Health Perspect. 106, 775-792.
Wiberg, K., Letcher, R.J., Sandau, C., Duffe, J., Norstrom, R.J., Haglund, P., Bidleman, T., 1998. Enantio-selective gas chromatography mass spectrometry of methylsulfonyl PCBs with application to arctic marine mammals. Anal. Chem. 70, 3845-3852.
Zhang, X., Yu, R.M.K., Jones, P.D., Lam, G.K.W., Newsted, J.L., Gracia, T., Hecker, M., Hilscherova, K., Sanderson, J.T., Wu, R.S.S., Giesy, J.P., 2005. Quantitative RT-PCR methods for evaluating toxicant-induced effects on steroi- dogenesis using the H295R cell line. Environ. Sci. Technol. 39, 2777-2785.