MUTATIONAL ANALYSIS OF StAR GENE IN ADRENAL TUMORS

Antonio STIGLIANO1, Stefania CAIOLA2, Ester SINISCALCHI1, Enrico PAPINI3, Anna CRESCENZI3, Salvatore MONTI1, Giorgio ARNALDI4, Franco MANTERO5, Francesco SCIARRA1 and Vincenzo TOSCANO1*

1II Endocrinologia, Dipartimento di Fisiopatologia Medica Università La Sapienza, Rome, Italy

2Istituto Superiore di Sanità, Rome, Italy

3 Ospedale Regina Apostolorum, Albano Laziale, Italy

4Clinica di Endocrinologia Università di Ancona, Ancona, Italy

5 Clinica di Endocrinologia Università di Padova, Padova, Italy

Adrenal adenomas and carcinomas are mostly monoclonal, suggesting that a genetic alteration in a progenitor cell may contribute to their development. However, the molecular pathogenesis of these tumors still remains unclear. It has been already excluded that activating mutations of the ACTH recep- tor or of G protein stimulator alpha sub-units, affecting cAMP pathway, is involved in the tumorigenesis. Therefore, this work has been focused on post-transductional (ACTH) signal alter- ations and in particular on the mutational analysis of the Steroid Acute Regulatory protein (StAR) gene to verify whether so- matic mutations or genomic polymorphisms of this gene may be correlated with adrenal tumorigenesis. Tissue DNA was extracted from 40 functional and non-functional adrenocortical tumors that were removed from patients aged between 17 and 72 years (mean 43 + 4). Blood DNA was obtained from 24 patients (aged between 26 and 70 years) affected by adrenal tumors and from 100 healthy subjects without radiological and clinical evidence of adrenal masses, aged between 25-35 years (90 Caucasians and 10 Africans). The DNA was used as the template for the amplification of the StAR gene using the poly- merase chain reaction. The amplified DNA of each exon of the StAR gene was purified and sequenced in automatic sequencia- tor. With the exception of exon 5 showing in codon 203 an homozygous missense mutation, the sequence of the other exons of the StAR gene resulted normal in all tumors studied. The same homozygous mutation (Asp203Ala) was observed in the sequence of exon 5 performed on genomic DNA of the 24 affected patients and in the control subjects. The homozigous- ity of the mutation observed in all patients (either in tissue or blood samples) and in control subjects, independently of their ethnic origin, led us to suggest that the Asp203Ala cannot be considered as mutation or as polymorphism, but that it must be considered as a mistake in the sequence entered in the Gen- bank, which needs to be modified accordingly. These data, and those up to now reported in the literature, allow us to suggest that mutations of the gene coding for the protein involved in the initial step of the steroidogenesis could not be considered as a possible cause for the development of adrenal tumors. @ 2002 Wiley-Liss, Inc.

Key words: human mutation; StAR gene; adrenal neoplasia

Seventy to ninety percent of adrenal tumors are benign. When these tumors do not hypersecrete hormones, their discovery occurs by chance during radiological examinations performed for other clinical problems.1,2 A small percentage of adrenal tumors are malignant and only very few are diagnosed according to their hormonal hypersecre- tion, leading to their characteristic clinical manifestations.

Adrenal adenomas and carcinomas are mostly monoclonal,3 sug- gesting that a genetic alteration in a progenitor cell may contribute to tumorigenesis. However, the molecular pathogenesis of these tumors remains unclear.4 It has been already excluded that activating muta- tions of the ACTH receptors4 or of G protein stimulator alpha sub- units are involved in the tumorigenesis due to an impaired cAMP pathway.5 Therefore our interest has been focused on the possible alterations localized in the post-trasductional signals and in particular on mutational analysis of the Steroid Acute Regulatory protein (StAR) gene, which represents a rate limiting step in the steroidogenesis process, to verify if somatic mutations or genomic polymorphism of this gene may be correlated with adrenal tumorigenesis. The rational basis of our study on the mutational analysis of this gene is based on

the observation that an intrinsic alteration of steroidogenesis is de- scribed in most of the adrenal tumors,6 even in the absence of clinical symptoms. The observation that patients affected by 21-OH lase deficiency develop adrenal masses, more often described in homozi- gous compared to heterozigous,7-12 strongly supports the rationale of our study. Moreover recent studies reported the observation that subjects with Congenital Lipoid Adrenal Hyperplasia (CLAH) may develop testicular neoplasias and ovarian cysts.13,14 This is the reasons that in these patients the pediatrician’s therapeutic approach is mainly preventive, with a precise indication toward adrenalectomy.15 The StAR mutations that have been described until now are all correlated with Congenital Lipoid Adrenal Hyperplasia (CLAH) and are repre- sented by transitions and/or transversions and mostly localized in exon 5.16-20 Moreover a genetic polymorphism (Asp203Ala) in exon 5 that is not correlated with any clinical manifestation has been already described.21 In this article, we report the results of the muta- tional analysis of the StAR gene performed on 40 adrenal tumors, showing different histological types and the results of the study of the genomic polymorphism performed in the patients (when genomic DNA was available) and in 100 control subjects of various ethnic origins.

MATERIAL AND METHODS

Patients and tumor specimens

Tumor tissue was obtained at adrenalectomy. Tumors were frozen in liquid nitrogen immediately after surgical removal and stored at -80°℃ until analyzed. Diagnosis was established by clinical and hystological criteria. Forty adrenocortical tumors were studied: 3 non-functional adenomas, 2 non-functional carcinomas, 2 aldosterone-producing adenomas, 14 cortisol-producing adeno- mas, 13 cortisol-producing carcinomas, 4 androgen-producing car- cinomas and 2 macronodular cortisol-producing hyperplasias. The tumors were obtained from patients aged between 17 and 72 years (mean 43 ± 4); 94% of these were females and most affected by functional neoplasia (Table I). This casuistry reflects the incidence of adrenal neoplastic disease for age and gender.22-25

DNA extraction

The DNA from the tumors was extracted by using the Qiagen tissue kit (Qiagen, Hildesheim, Germany). Blood DNA obtained from 24 of the patients affected by adrenal tumors (aged between 26 and 70 years) was extracted using the Qiagen blood kit (Qiagen,

Grant sponsor: Il Endocrinologia, Dipartimento di Fisiopatologia Med- ica Università di Roman “La Sapienza;” Grant sponsor: Istituto Superiore di Santià.

*Correspondence to: II Endocrinologia, Dip Fisiopatologia Medica, Uni- versità La Sapienza, Rome, Italy. Fax: +39-06-445-5345 or +39-06- 49053. E-mail: i.s.g.s.h@agora.stm.it or vincenzo.toscano@uniroma1.it

TABLE I-CLINICAL DATA AND PATHOLOGICAL FEATURES OF 40 PATIENTS WITH ADRENAL TUMORS
Tumor numberAgeSexMaximum diameter (mm)Clinical and pathological features
155F30Non-functional adenoma
252F40Non-functional adenoma
341F40Non-functional adenoma
423F90Adrenocortical carcinoma (non functional)
534M35Adrenocortical carcinoma (non functional)
657F20Aldosterone producing adenoma
739M30Aldosterone producing adenoma
848F45Cortisol producing adenoma
929F40Cortisol producing adenoma
1050M30Cortisol producing adenoma
1165F40Cortisol producing adenoma
1226F30Cortisol producing adenoma
1355F40Cortisol producing adenoma
1446F30Cortisol producing adenoma
1563F45Cortisol producing adenoma
1625F30Cortisol producing adenoma
1740F30Cortisol producing adenoma
1839F30Cortisol producing adenoma
1946F30Cortisol producing adenoma
2034F30Cortisol producing adenoma
2157F50Cortisol producing adenoma
2233M30Adrenocortical carcinoma (cortisol producing)
2370F45Adrenocortical carcinoma (cortisol producing)
2469F90Adrenocortical carcinoma (cortisol producing)
2542F120Adrenocortical carcinoma (cortisol producing)
2654M150Adrenocortical carcinoma (cortisol producing)
2743M110Adrenocortical carcinoma (cortisol producing)
2850F160Adrenocortical carcinoma (cortisol producing)
2959F110Adrenocortical carcinoma (cortisol producing)
3026F150Adrenocortical carcinoma (cortisol producing)
3125F80Adrenocortical carcinoma (cortisol producing)
3256F160Adrenocortical carcinoma (cortisol producing)
3318F50Adrenocortical carcinoma (cortisol producing)
3450F40Adrenocortical carcinoma (cortisol producing)
3550F70Adrenocortical carcinoma (androgen producing)
3617F60Adrenocortical carcinoma (androgen producing)
3727F100Adrenocortical carcinoma (androgen producing)
3827F35Adrenocortical carcinoma (androgen producing)
3954F48Macronodular hyperplasia (cortisol producing)
4050F27Macronodular hyperplasia (cortisol producing)
TABLE II - SEQUENCE OF OLIGONUCLEOTIDES THAT WERE USED FOR AMPLIFICATION OF EXONS OF THE StAR GENE
Exon I
Sense5' - AGGCTGCAGCTGCGGGACTCAGAG G-3'
Antisense5' - TCGCCTCCTTCCCGCAGCGCTCAC- 3'
Exon II
Sense5' - AACAAGGGTTATTCCCTTCTGCAG- 3'
Antisense5' - GAGCCCAGAAGCCTCAGCACTTAC- 3'
Exon III
Sense5' - GTCTCTCCTCGGCTGTGTATCCAG- 3'
Antisense5' - CACAGGCTTCTCCCCGACACTTAC - 3'
Exon IV
Sense5' - TCTGGGGGCTCCTTTCTCTGACAG- 3'
Antisense5' - CACCCGCACCTGGACTTTGGTCAC- 3'
Exon V
Sense5'- TTCTGGTTCCCCATGGCCTGGTAG - 3'
Antisense5' - GTTTGGAGCCTGCTGCCCGTATTA C-3'
Exon VI
Sense5' - GACTTGACTTGCTCCATTTGCCAG- 3'
Antisense5' - AGGTCCCCCTCCCATGCCCTTCAC- 3'
Exon VII
Sense5' - AAATTCTCCTACCTCCTACTGCAG- 3'
Antisense5' - CCAGTGCAGCTGGGCACAGTTGG-3'

Hildesheim, Germany). Blood DNA obtained from 100 healthy subjects, aged between 25 and 35 years, were used as controls. These subjects, 90 Caucasians and 10 Africans, according to data from ethnic studies, which demonstrated the prevalence of adrenal neoplastic disease in white subjects compared to blacks,26-28 had no radiological and clinical evidence of adrenal masses. The study was approved by local Ethical Committee.

PCR and sequencing analysis

The DNA was used as the template for the amplification of the intronless StAR gene by the polymerase chain reaction (PCR) (PCR System 9700 Perkin Elmer). The pair of flanking primers used (Life Technologies, GIBCO-BRL, Gaithersburg, MD) is re- ported in Table I. The PCR protocol comprised 5 min melting of

the strands at 94℃, then 30 sec of denaturation at 94℃, 30 sec of annealing at 60℃ and 30 sec of extension at 72℃, for 35 cycles. The final extension was performed for 10 min at 72℃, the reaction taking place in 20 ul volume containing Taq DNA polymerase (Promega Corp, Milan, Italy) with MgCl2 at 2.5 mM. The expected size bands on agarose gel electrophoresis were as follows: 203 bp for exon 1, 114 bp for exon 2, 126 bp for exon 3, 159 bp for exon 4, 185 bp for exon 5, 94 bp for exon 6, and 113 bp for exon 7. The amplified DNA of each exon of StAR gene was purified by filtra- tion through a Amicon membrane (Micropure-0.22 Separator, Amicon, Inc., Beverly, MA) and sequenced in automated DNA sequencer (Perkin-Elmer Cetus) with Dye-Deoxy® Rhodamine Terminator Cycle Sequencing kit (PE/ABI), using unlabeled PCR primers as sequencing primers, according to the manufacturer’s protocol. The base calling was determined automatically by ABI PRISM Sequencing Analysis 3.0 software.

RESULTS

Each exon of the StAR gene was successfully amplified by PCR and shown to have the expected size bands on agarose gel elec- trophoresis. With the exception of exon 5 that showed in codon 203 an homozygous missense mutation with the substitution of Asp with Ala respect to the wild-type sequence (GenBank acces- sion NM_000349 (gi:4507250) (Fig. 1), the automatic sequence of other exons of the StAR gene revealed a normal sequence in all tumors studied.

The same homozygous mutation (Asp203Ala) was observed in the sequence of exon 5 performed on genomic DNA of the 24 patients whose DNA was available.

To clarify if this mutation may be correlated with a silent polymorphism presented by patients developing adrenal tumors, exon 5 of the StAR gene from genomic DNA of control subjects was sequenced and in 100% of the cases, the same homozygous mutation (Asp203Ala) was observed.

DISCUSSION

This paper reports the results of the StAR gene mutational analysis performed on 40 adrenal tumors with different histolog- ical characteristics and in a group of 100 healthy subjects. In all cases an homozigous missense apparent mutation Asp203Ala (exon 5) of the StAR gene was shown. To our knowledge this is the first report in the literature that shows the results of mutational analysis of the StAR gene in adrenal tumors. Previous papers have demonstrated comparable expression of the StAR mRNA in normal and neoplastic adrenal tissues.29-32 These results, however, do not permit excluding that StAR gene mutation may be involved in adrenal tumorigenesis.

The StAR gene mutations, until now described, are mostly localized in exon 5 and all identified in patients affected by CLAH.16,33 Otherwise the possibility that an altered steroidogen- esis, even in the cases not associated with clinical hormonal abnormalities, may be involved in adrenal tumorigenesis has been

FIGURE 1 - Schematic representation of exon 5 of the StAR gene. Comparison of the partial sequence encoding the normal and mutated StAR gene. The arrow indicates the codon site of a single point mutation.

Esone five of StAR gene

V

GenBank gi:4507250

203

Gly Met Asp Asp Phe GGC ATG GAC ACA GAC TTC

Thr

Mutation

1

Gly

203 Ala

Met

Thr

Asp

Phe

GGCATGGCCACAGACTTC

already advanced.34-36 However, up to now no clear evidence for enzyme gene mutation along adrenal steroid pathways has been shown, even for the 21 hydroxylase gene37 whose mutation was strongly suggested by the high response of 17-hydroxyprogester- one after ACTH stimulation shown in 30-70% of the patients affected by adrenal incidentalomas.38,39

The observation that the StAR gene apparent mutation Asp203Ala was found in all subjects studied, both in controls and in those affected by adrenal tumor, led us to exclude that this apparent sequence change may be involved in adrenal tumorigen- esis.36 It is difficult to accept this apparent mutation as polymor- physm because if this is the case, it would be expected to find in some people the same sequence comparable to that entered in the Genbank, or at least some heterozygous subject. A most recent entry in the Genbank of 19 March 1999 (accession NM_ 000349; gi:4507250) for StAR gene sequence reported the GAC at the codon 203. The possibility that this apparent mutation may be a polymorphysm that predisposes to the development of adrenal tumors could be postulated. Considering however that the preva- lence of the adrenal tumors (including incidentalomas) cannot be

expected to be higher than 10%6 in the general population, we should expect the mutation in the same percentage of the cases in our controls, at least in homozygousity. Therefore the observation of the homozigousity of the apparent mutation in the 100% of patients and controls independently of their ethnic origin lead us to suggest that Asp203Ala has to be considered only as a mistake of the sequence entered in the Genbank, which could be modified accordingly.

On the basis of this body of evidence, we suggest that mutations of the gene coding for the protein involved in the initial step of the steroidogenesis cannot be considered involved in the development of functional or non-functional adrenal tumors, as well as exclud- ing the involvement of gene mutations in the mechanisms of the ACTH signal induction.

ACKNOWLEDGEMENT

This work was performed within a collaboration between Il Endocrinologia, Dipartimento di Fisiopatologia Medica Università di Roman “La Sapienza” and Istituto Superiore di Santià.

REFERENCES

1. Chidiac RM, Aron DC. Incidentalomas: a disease of modern technol- ogy. End Metab Clin North Am 1997;26:233-53.

2. Griffing G. A-I-D-S: The new endocrine epidemic (Editorial com- ment). J Clin End Metab 1994;74:1530-1.

3. Beuschlein F, Reincke M, Karl M, et al. Clonal composition of human adrenocortical neoplasm. Cancer Res 1994;54:4927-32.

4. Latronico AC, Reincke M, Mendonca BB, et al. No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in hu- man adrenocortical neoplasm. J Clin End Metab 1995;80:875-877.

5. Lyons J, Landis CA, Harsh G, et al. Two G protein oncogenes in human endocrine tumors. Science 1990;249:655-659.

6. Copeland PM. The incidentally discovered adrenal mass. Ann Int Med 1983;98:940-945.

7. Bauman A, Bauman CG. Virilizing adrenocortical carcinoma: devel- opment in a patient with salt-losting congenital adrenal hyperplasia. JAMA 1982;248:3140.

8. Daeschner GL. Adrenal cortical adenoma arising in a girl with con- genital adrenogenital syndrome. Pediatrics 1965;36:140.

9. Jaresch S, Kornely E, Kley HK, et al. Adrenal incidentaloma and patients with homozygous and heterozygous congenital adrenal hy- perplasia. J Clin End Metab 1992;74:685.

10. Jaursch-Hancke C, Allolio B, Metzler U, et al. Adrenocortical carci- noma in patients with untreated congenital adrenal hyperplasia (CAH). Acta End 1988;117:146.

11. Lack EE, Kozakewich HP. Embriology, developmental anatomy, and selected aspects of non-neoplastic pathology. In: Lack EE, ed. Pathol- ogy of the adrenal glands. New York: Churchill Livingstone, 1990. 1.

12. Pang S, Becker D, Cotelingam J, et al. Adrenocortical tumor in a patient with congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Pediatrics 1981;68:242.

13. Korsch E, Peter M, Hiort O, et al. Gonadal histology with testicular carcinoma in situ in a 15-year-old 46, XY female patient with a premature termination in the Sterodogenic Acute Regulatory Protein causing congenital lipoid adrenal hyperplasia. J Clin End Metab 1999;84:1628.

14. Shima M, Tanae A, Miki K, et al. Mechanism for the development of ovarian cysts in patients with congenital lipoid adrenal hyperplasia. Eur J End 2000;142:274.

15. New MI, Speiser PW. Genetics of adrenal steroid 21-hydroxylase deficiency. End Rev 1986;7:331.

16. Bose HS, Sugawara T, Strauss JF III, et al. The pathophysiology and genetics of congenital lipoid adrenal hyperplasia. New Engl J Med 1996;335:1870-8.

17. Tee MK, Lin D, Sugawara T, et al. TA transversion 11bp from a splice acceptor site in the gene for steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. Hum Mol Gen 1995;4:2299-2305.

18. Bose HS, Pescovitz OH, Miller WL. Spontaneous feminization 46, XX female patient with congenital lipoid adrenal hyperplasia due to a homozygous frameshift mutation in the steroidogenic acute regulatory protein. J Clin End Metab 1997;82: 1511-5.

19. Okuyama E, Nishi N, Onishi S, et al. A novel splicing Junction mutation in the gene for the steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. J Clin End Metab 1997; 82:2337-42.

20. Nakae J, Tajima T, Sugawara T, et al. Analysis of the steroidigenic acute regulatory protein (StAR) gene in Japanese patients with con- genital lipoid adrenal hyperplasia. Hum Mol Gen 1997;6:571-6.

21. Katsumata N, Tanae A, Shinagawa T, et al. Novel frameshift mutation 840delA and a novel polymorphism D203A in the steroidogenic acute regulatory protein gene in a Japanese patient with congenital lipoid adrenal hyperplasia. Hum Mut Suppl 1998;1:304-7.

22. Wooten MD, King DK. Adrenal cortical carcinoma. Epidemiology and treatment with mitotane and a review of the literature. Cancer 1993;72:3145.

23. Bodie B, Novick AC, Pontes JE. The Cleveland Clinic experience with adrenal cortical carcinoma. J Urol 1989;141:257.

24. Henley DJ, van Heerden JA, Grant CS. Adrenal cortical carcinoma: a continuing challenge. Surgery 1983;94:926.

25. Icard PH, Louvel A, Chapuis Y. Survival rates and prognostic factors in adrenocortical carcinoma. World J Surg 1992;16:753.

26. Nader S, Hickey RC, Sellin RV, et al. Adrenal cortical carcinoma: a study of 77 cases. Cancer 1983;52:707.

27. King DR, Lack EE. Adrenal cortical carcinoma: a clinical and patho- logical study of 49 cases. Cancer 1979;44:239.

28. Hutter AM Jr, Kayhoe DE. Adrenal cortical carcinoma: clinical fea- tures of 138 patients. Am J Med 1966;41:572.

29. Liu J, Heikkila P, Kahri AI, et al. Expression of the steroidogenic acute regulatory protein mRNA in adrenal tumors and cultured adre- nal cells. J Endocrinol 1996;150,43-50.

30. Reincke M, Beuschlein F, Lalli E, et al. DAX-1 expression in human adrenocortical neoplasm: implications for steroidogenesis. J Clin End Metab 1998;83:2597-2600.

31. Mancini V, Arnaldi G, Costantini C, et al. Expression of StAR protein and steroidogenic enzymes in adrenocortical tumors. J End Inv 1999; 22:4:33.

32. Zenckert S, Schubert B, Fassnacht M, et al. Steroidogenic acute regulatory protein mRNA expression in adrenal tumours. Eur J End 2000;142:294-9.

33. Miller WL, Strauss JF III. Molecular pathology and mechanism of action of the steroidogenic acute regulatory protein, StAR. J Ster Bio Mol Biol 1999;69:131-41.

34. Sasano H, Suzuki T, Nagura H, et al. Steroidogenesis in human adrenocortical carcinoma: biochemical activities, immunohistochem- istry, and in situ hybridization of steroidogenic enzymes and his- topathologic study in nine cases. Hum Pat 1993;24:397-404.

35. Rapaport E, Goldnberg MB, Gordan GS. Mortality in surgically treated adrenocortical tumors. II. Review of cases reported for the 20 year period 1930-1949, inclusive. Postgrad Med 1952;11:325.

36. Muller J. Adrenocortical tumors: clinical and diagnostic findings. Res Cancer Res 1990;118:106.

37. Beuschlein F, Schulze E, Mora P, et al. Steroid 21-hydroxylase mutations and 21-hydroxylase messenger ribonucleic acid expression in human adrenocortical tumors. J Clin End Metab 1998;3:2585-8.

38. Terzolo M, Osella G, Ali A, et al. Different patterns of steroid secretion in patients with adrenal incidentalomas. J Clin End Metab 1996;81:740-4.

39. Mantero F, Masini AM, Opocher G, et al. Adrenal incidentaloma: an overview of hormonal data from the national Italian study group. Horm Res 1997;47:284-9.