ELSEVIER
Expression of urotensin II and urotensin II receptor mRNAs in various human tumor cell lines and secretion of urotensin II-like immunoreactivity by SW-13 adrenocortical carcinoma cells
Kazuhiro Takahashia,*, Kazuhito Totsuneb, Osamu Murakamib, Shigeki Shibaharaª
aDepartment of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi 980- 8575, Japan
bDepartment of Medicine, Tohoku University School of Medicine, Sendai 980-8575, Japan
Received 23 October 2000; accepted 1 March 2001
Abstract
Urotensin II is the most potent vasoconstrictor peptide identified so far. Expression of urotensin II and urotensin II receptor mRNAs was studied in various human tumor cell lines by reverse transcriptase polymerase chain reaction (PCR) method. Secretion of urotensin II by these tumor cells was studied by radioimmunoassay. The tumor cell lines studied were T98G glioblastoma cells, IMR-32 neuroblastoma cells, NB69 neuroblastoma cells, BeWo choriocarcinoma cells, SW-13 adrenocortical carcinoma cells, DLD-1 colorectal adenocarcinoma cells and HeLa cervical cancer cells. Urotensin II mRNA was expressed in 6 tumor cell lines except for NB69 neuroblastoma cells. Urotensin II receptor mRNA was expressed in all 7 tumor cell lines. A significant amount of urotensin II-like immunoreactivity was detected only in the culture medium of SW-13 adrenocortical carcinoma cells by radioimmunoassay. Sephadex G-50 column chromatography showed that the urotensin II-like immunoreactivity in the culture medium extract was eluted earlier than synthetic human urotensin II, suggesting that SW-13 cells secreted higher molecular weight materials, perhaps partially processed forms of the urotensin II precursor. Reverse phase high-performance liquid chromatography (HPLC) showed three immunoreactive peaks, one of which was eluted in the position of urotensin II. The present study has shown for the first time expression of urotensin II and urotensin II receptor mRNAs in various tumor cell lines and the secretion of urotensin II-like immunoreactivity by SW-13 adrenocortical carcinoma cells. @ 2001 Elsevier Science Inc. All rights reserved.
Keywords: Urotensin II; Tumor; Cancer; Adrenocortical
1. Introduction
Urotensin II (U-II) is a “somatostatin-like” cyclic peptide which was originally isolated from fish spinal cords [3,9]. Cloning of the cDNA encoding the human U-II precursor has revealed that human U-II, a 11-amino-acid peptide, is generated from the U-II precursor consisting of 124 amino acids by the post-translational proteolytic processing [4]. The reverse pharmacological approach has shown that U-II is an agonist for the orphan receptor GPR14 [1]. U-II is a potent vasoconstrictor peptide and its potency of vasocon- striction is one order of magnitude greater than endothelin-1 [1,6]. U-II mRNA was expressed in the medulla oblongata,
the spinal cord and various peripheral tissues, such as kid- ney, spleen, small intestine, thymus, prostate, pituitary gland and adrenal gland [4]. U-II is also expressed in human cardiac tissue and arteries [1]. U-II receptor (GPR14) mRNA was abundantly expressed in the heart and pancreas [1].
It is known that some vasoactive peptides are produced and secreted by tumor cells and act as a paracrine growth stimulator. For example, endothelin-1 is produced and se- creted by various cultured tumor cells, such as lung cancer cells, brain tumor cells, colonic cancer cells, adrenocortical cancer cells and cervical cancer cells [5,10,11,17,18,20] and shown to stimulate proliferation of tumor cells [2,10]. Ad- renomedullin, a potent vasodilator peptide originally iso- lated from pheochromocytoma, is produced and secreted by various cultured tumor cells, like endothelin-1 [7,8,12,14, 15,18,20]. Adrenomedullin has been also shown to stimu-
* Corresponding author. Tel .: +81-22-717-8116; fax: +81-22-717- 8118.
E-mail address: ktaka-md@mail.cc.tohoku.ac.jp (K. Takahashi).
late proliferation of tumor cells [7]. However, expression of U-II or U-II receptor in tumors has not been studied so far. We therefore studied expression of U-II and U-II receptor mRNAs in various human tumor cell lines by reverse tran- scriptase PCR (RT-PCR) method, and the secretion of U-II from these cultured cells by radioimmunoassay.
2. Materials and methods
2.1. Cell culture
T98G human glioblastoma cells, SW-13 human adreno- cortical carcinoma cells, DLD-1 human colorectal adeno- carcinoma cells, and HeLa human cervical cancer cells were cultured, as previously reported [8,13-15,19]. IMR-32 hu- man neuroblastoma cells were obtained from the Cancer Cell Repository, Institute of Development, Aging and Can- cer Tohoku University (Sendai, Japan) and were cultivated at 37°℃ under 5% CO2 in minimum essential medium sup- plemented with 10% fetal bovine serum (FBS). BeWo hu- man choriocarcinoma cells were obtained from the Human Science Research Resources Bank of the Japan Health Sci- ences Foundation (Osaka, Japan), and were cultivated in Ham’s F12 medium supplemented with 15% FBS. NB69 human neuroblastoma cells were obtained from the Riken Cell Bank (Tsukuba, Japan) and were cultivated in RPMI 1640 medium supplemented with 15% FBS.
The cells were cultured at a density of approximately 2.0 × 106 cells/10 ml medium for 24 h. The culture media were collected for the measurement of U-II-like immuno- reactivity (U-II-LI) and the cells were for the RNA extrac- tion.
2.2. RT-PCR
Total RNA was extracted from tissues and cultured cells by the guanidine thiocyanate-cesium chloride method. Total RNA (6 µg) was denatured at 70℃ for 10 min and then transcribed at 42℃ for 60 min in a reaction mixture (20 ul) containing 2.5 µg oligo-dT, 0.5 mmol/liter dNTP and 200 units of reverse transcriptase (SuperScript II; BRL, Gaith- ersburg, MD). The reaction was stopped by heating at 95℃ for 5 min, and stored at -20℃ until PCR analysis. One pl of the reaction mixture was subjected to PCR. The sense primer was 5’-CTTTCAACTCTCAGCACCTCAT-3’ (nu- cleotide numbers 122/143) and the anti-sense primer was 5’-CCTAGTTTTTCTCCACACTGTT-3’ (complementary to 485/506). The nucleotide residues were numbered ac- cording to the registered cDNA sequence of homo sapiens urotensin II precursor (accession no. AF104118) [4]. There were two introns between the sense and anti-sense primers and one intron within the sequence of the sense primer in the urotensin II gene (accession no. Z98884). One ul of water was used instead of the reaction mixture in a negative control. The PCR was performed in a total volume of 20 pl
containing 10 mmol/liter Tris HCl (pH 8.3), 50 mmol/liter KCl, 2 mmol/liter MgCl2, 0.2 mmol/liter of each dNTP, 0.25 mmol/liter of each primer, and 0.5U Taq DNA poly- merase (Pharmarcia, Piscateway, NJ). After heating at 94°℃ for 2 min, denaturation, annealing and elongation were carried out at 94℃ for 15 s, 58℃ for 60 s and 72°℃ for 90 s, respectively, and the reactions were repeated 40 cycles, followed by 72℃ for 5 min.
RT-PCR for U-II receptor (human GPR14) was per- formed using a sense primer CCCCAACGCAACCCT CAACA (nucleotide numbers 81-100) and an antisense primer GGTCGCGGTAGTTCCTGGTGA (complementary to 953-973) (accession no. AF140631). After heating at 96°℃ for 2 min, denaturation, annealing and elongation were carried out at 96°℃ for 5 s, 97℃ for 5 s and 96℃ for 10 s (denaturation), 68℃ for 30 s, 72°℃ for 120 s, respec- tively, and the reactions were repeated 35 cycles, followed by 72℃ for 5 min. Expression of glyceraldehyde-3-phos- phate dehydrogenase (GAPDH) mRNA was examined as an internal control. The sense primer was 5’-GGTCGGAGT CAACGGATTTG-3’ (nucleotide numbers 75/94) and the anti-sense primer was 5’-ATGAGGTCCACCACCCT GTT-3’ (complementary to 1024/1043) (accession no. NM002046). One ul cDNA was amplified as follows: 25 cycles at 94℃ for 15 s, 60℃ for 30 s, 72℃ for 90 s; and then 72℃ for 5 min. Amplification products were visual- ized on a 5% polyacrylamide gel stained with ethidium bromide, and viewed on an ultraviolet box.
2.3. Radioimmunoassay
The peptides in the culture media were extracted using Sep-Pak C18 cartridges (Waters, Milford, MA) as previ- ously reported [12]. The extract was reconstituted with assay buffer [0.1 mol/liter phosphate buffer, pH 7.5 con- taining 0.1% (v/v) bovine serum albumin (BSA), 0.2% (v/v) Triton X-100, and 0.1% (w/v) sodium azide] and assayed. The recovery was determined by adding a known amount of human U-II to the medium prior to the extraction, and yielded more than 90%.
The polyclonal antibody against human U-II raised in a rabbit (Lot No. 992-500601) was obtained from the Peptide Institute, Inc. (Osaka, Japan). The antiserum was used at a final dilution of 1:6,000. 125I-U-II was obtained from Am- ersham Pharmacia Biotech Ltd., Tokyo, Japan. The assay was performed in 400 ul of assay buffer. The sample or the standard peptide (200 pl) was incubated with antiserum (100 pl) at 4℃ for 48 h and then 100 pl of 125I-U-II (about 2,500 cpm/100 pl) was added to each sample. After further 48-h incubation at 4℃, 100 ul of 5% anti-rabbit IgG raised in goat (ICN Biomedicals Inc., Costa Mesa, CA) and 500 pl of 10% (w/v) polyethylene glycol in water were added. After 5-h incubation, the sample was centrifuged at 3,000× g for 30 min and the supernatant was separated. The pellets were counted by the y-counter.
The standard curve range was 2-500 fmol/tube. The
assay could detect changes of 2.4 ± 0.6 fmol/tube (mean ± SD, n = 7) from zero at 95% confidence with duplicate tubes. The concentration of synthetic U-II to inhibit the antibody-radioligand binding by 50% was about 40 fmol/ tube. Intra- and interassay coefficients of variation were 8.8% and 13.9%, respectively. The cross reaction with U-II fragments (Sawady Technology Inc., Tokyo, Japan; Custom synthesis) were as follows; 0.0028% with U-II-(1-5) and 0.03% with U-II-(6-11). These findings suggest that the U-II antibody recognizes the entire molecule of U-II. Treat- ment of 1 nmol U-II with sodium metabisulfite (0.5 µmol/ ml) for 10 min, which might break the S-S bond of the peptide, reduced the immunoreactivity to 69% of the con- trol. Treatment of 1 nmol U-II with 3% H2O2 (w/w) also reduced it to 52% of the control. These findings suggest that the breakage of the S-S bond reduces the immunoreactivity of U-II. There was no significant cross reaction (less than 0.001%) with other peptides, including somatostatin, uro- cortin, atrial natriuretic peptide, C-type natriuretic peptide, neuropeptide Y (NPY), adrenomedullin, endothelin-1, va- sopressin, oxytocin, vasoactive intestinal polypeptide (VIP), substance P, pituitary adenylate cyclase activating polypep- tide-38, corticotropin releasing hormone (CRH), and growth hormone-releasing hormone (GH-RH).
2.4. Chromatography
Chromatographic characterization of U-II-LI in the cul- ture medium of SW-13 adrenocortical carcinoma cells was performed by Sephadex G50 column chromatography (su- perfine, 10 × 400 mm) and reverse phase HPLC using a uBondapak C18 column (3.9 mm × 300 mm, Waters, Milford, MA, USA).
The culture medium was extracted by a Sep-Pak C18 cartridge (Waters). The extracts were reconstituted in 1 mol/liter acetic acid containing 0.5% (w/v) BSA and loaded onto the Sephadex G-50 column. Peptides on the column were eluted with 1 mol/liter acetic acid containing 0.5% (w/v) BSA at a flow rate of 10 ml/h. Fractions (0.65 ml/ fraction) were collected, dried by air, reconstituted in assay buffer and assayed. The elution positions of synthetic hu- man CNP-22, human CNP-53 and urocortin (Peptide Insti- tute) were determined as the molecular weight markers [16,21].
For the HPLC analysis, the extract of the culture medium was reconstituted in 0.1% (v/v) trifluoroacetic acid (TFA) and loaded onto the column. The HPLC analysis was per- formed with a linear gradient of acetonitrile containing 0.1% TFA from 10% to 60% at a flow rate of 1 ml/min per fraction over 50 min. Each fraction (1 ml) was collected, dried by the air, reconstituted with assay buffer and assayed.
2.5. Statistics
Data are shown as mean + SEM, unless otherwise stated. Statistical analysis was performed by one-way anal-
MM
T98G
IMR-32
NB69
BeWo
SW-13
DLD-1
HeLa
400 bp
U-II mRNA
1000 bp
U-II receptor mRNA
600 bp
1000 bp
GAPDH mRNA
600 bp
ysis of variance, followed by Fisher’s protected least sig- nificant difference.
3. Results
RT-PCR analysis showed that U-II mRNA was ex- pressed in 6 out of 7 tumor cell lines examined (T98G glioblastoma cells, IMR-32 neuroblastoma cells, BeWo choriocarcinoma cells, SW-13 adrenocortical carcinoma cells, DLD-1 colorectal adenocarcinoma cells and HeLa cervical cancer cells) (Fig. 1). U-II receptor mRNA was expressed in all 7 tumor cell lines (6 tumor cell lines plus NB69 neuroblastoma cells). A negative control showed no band (data not shown).
A significant amount of U-II-LI was detected only in the culture medium of SW-13 adrenocortical carcinoma cells by radioimmunoassay. The dilution curve of the culture me- dium extract of SW-13 cells was parallel with the standard curve of U-II (data not shown). U-II-LI accumulated in the culture medium of SW-13 cells time-dependently. U-II-LI concentrations in the 24-h culture medium and 32-h culture medium were significantly higher than those in the uncon- ditioned medium (Fig. 2). On the other hand, there was no significant difference in the U-II-LI levels between the un- conditioned medium and the medium cultured for 24 h by the following cells; T98G glioblastoma cells, IMR-32 neu- roblastoma cells, NB69 neuroblastoma cells, BeWo chorio- carcinoma cells, DLD-1 colorectal adenocarcinoma cells or HeLa cervical cancer cells (P > 0.1).
Sephadex G-50 column chromatography of the culture medium extract of the SW-13 cells showed that the U-II-LI was eluted earlier than synthetic human U-II. The peak was found in the area between human CNP-53 and urocortin (a 40-amino-acid peptide) (Fig. 3A). Reverse phase HPLC showed three immunoreactive peaks, one of which was eluted in the position of U-II (Fig. 3B).
*
*
3.0
U-II-LI (pmol/l)
2.0
1.0
0.0
Unconditioned
8 h
16 h
24 h
32 h
4. Discussion
The present study has shown for the first time the ex- pression of U-II and U-II receptor mRNAs in various hu- man tumor cell lines. On the other hand, U-II-LI was de- tected only in the culture medium of SW-13 adrenocortical carcinoma cells. This may be due to the fact that the amount of U-II-LI secreted by the other cell lines was too small to be detected. Sephadex G-50 column chromatography showed, however, that the U-II-LI secreted by SW-13 cells was eluted in the larger molecular weight region; between human CNP-53 and urocortin (a 40-amino-acid peptide). These findings raise the possibility that SW-13 cells se- creted larger molecular weight substances consisting of 40-50 amino acids, perhaps partially processed forms of the urotensin II precursor. Human UT-II is generated from the 124-amino-acid precursor [4]. Reverse phase HPLC showed three immunoreactive peaks, suggesting that the U-II-LI secreted by SW-13 cells consisted of at least three molec- ular forms. Material eluting in the position of human U-II on HPLC may not be identical to human U-II, because no material was found in the position of human U-II in the Sephadex G50 column chromatography.
We have previously shown the production and the secre- tion of two vasoactive peptides, adrenomedullin and endo- thelin-1 by SW-13 adrenocortical carcinoma cells [20]. On the other hand, the secretion of calcitonin gene-related pep- tide, CRH, NPY or urocortin was not observed in these cells. Thus, U-II is the third peptide that we found to be secreted by the SW-13 adrenocortical carcinoma cells. Both adrenomedullin and endothelin-1 are known to stimulate the growth of tumor cells [7,10]. It has been shown that U-II
A
25
< Vo
< CNP-53
€- UC
<CNP-22
EU-II
20
U-II-LI (fmol/ml)
15
10
5
0
0 10 20 30 40 50 60
fraction
B
U-II
3
V
80
60
U-II-LI (fmol/ml)
2
acetonitrile (%)
40
1
20
0
0
10 20 30 40 50
0
minutes
stimulated calcium mobilization in the cells stably trans- fected with U-II receptor, GPR14 [1]. It is therefore plau- sible that U-II may act on tumor cells, stimulate calcium mobilization, and perhaps affect the growth of the tumor cells as an autocrine/paracrine factor.
Acknowledgments
This work was supported in part by the Mochida Memo- rial Foundation for Medical and Pharmaceutical Research.
References
[1] Ames RS, Sarau HM, Cambers JK, et al. Human urotensin II is a potent vasoconstrictor and agonist for the orphan receptor GPR14. Nature 1999;401:282-6.
[2] Asano T, Aoyagi M, Hirakawa K, Ikawa Y. Effect of endothelin-1 as a growth factor on a human glioma cell line: its characteristic pro- motion of DNA synthesis. J Neurooncol 1984;18:1-7.
[3] Conlon JM, Tostivint H, Vaudry H. Somatostatin-, and urotensin II-related peptides: molecular diversity, and evolutionary perspec- tives. Regul Pept 1997;69:95-103.
[4] Coulouarn Y, Lihrmann I, Jegou S, et al. Cloning of the cDNA encoding the urotensin II precursor in frog and human reveals intense expression of the urotensin II gene in motoneurons of the spinal cord. Proc Natl Acad Sci USA 1998;95:15803-8.
[5] Kusuhara M, Yamaguchi K, Nagasaki K, et al. Production of endo- thelin in human cancer cell lines. Cancer Res 1990;50:3257-61.
[6] MacLean MR, Alexander D, Stirrat A, et al. Contractile responses to human urotensin-II in rat and human pulmonary arteries: effect of endothelial factors and chronic hypoxia in the rat. Brit J Pharmacol 2000;130:201-4.
[7] Miller MJ, Martinez A, Unsworth EJ, et al. Adrenomedullin expres- sion in human tumor cell lines. J Biol Chem 1996;271:23345-51.
[8] Nakayama M, Takahashi K, Murakami O, Shirato K, Shibahara S. Induction of adrenomedullin by hypoxia and cobalt chloride in human colorectal carcinoma cells. Biochem Biophys Res Commun 1998; 243:514-7.
[9] Pearson D, Shively JE, Clark BR, Geschwind II, Barkley M, Nishioka RS, Bern HA. Urotensin II: a somatostatin-like peptide in the caudal neurosecretory system of fishes. Proc Natl Acad Sci USA 1980;77: 5021-4.
[10] Shichiri M, Hirata Y, Nakajima T, et al. Endothelin-1 is an autocrine/ paracrine growth factor for human cancer cell lines. J Clin Invest 1991;87:1867-71.
[11] Sone M, Takahashi K, Totsune K, et al. Expression of endothelin-1 and endothelin receptors in cultured human glioblastoma cells. J Car- diovasc Pharmacol 2000;26(Suppl. 1):S390-S392.
[12] Takahashi K, Satoh F, Hara E, Murakami O, Kumabe T, Tominaga T, Kayama T, Yoshimoto T, Shibahara S. Production and secretion of adrenomedullin by cultured choroid plexus carcinoma cells. J Neu- rochem 1997;68:726-31.
[13] Takahashi K, Hara E, Ogawa K, Kimura D, Fujita H, Shibahara S. Possible implications of the induction of human heme oxygenase-1 by nitric oxide donors. J Biochem 1997;121:1162-8.
[14] Takahashi K, Satoh F, Hara E, et al. Production and secretion of adrenomedullin from glial cell tumors and its effects on cAMP production. Peptides 1997;18:1117-24.
[15] Takahashi K, Satoh F, Sone M, et al. Expression of adrenomedullin mRNA in adrenocortical tumors and secretion of adrenomedullin by cultured adrenocortical carcinoma cells. Peptides 1998;19:1719-24.
[16] Takahashi K, Totsune K, Sone M, Murakami O, Satoh F, Arihara Z, Sasano H, Iino K, Mouri T. Regional distribution of urocortin-like immunoreactivity and expression of urocortin mRNA in the human brain. Peptides 1998;19:643-7.
[17] Takahashi K, Hara E, Murakami O, et al. Production and secretion of endothelin-1 by cultured choroid plexus carcinoma cells. J Cardio- vasc Pharmacol 1998;31(Suppl. 1):S367-S369.
[18] Takahashi K, Nakayama M, Shibahara S. Production and secretion of neuropeptides by nervous system tumors. Canc J 1998;11:237-41 (Review).
[19] Takahashi K, Nakayama M, Takeda K, Fujita H, Shibahara S. Sup- pression of heme oxygenase-1 mRNA expression by interferon-y in human glioblastoma cells. J Neurochem 1999;72:2356-61.
[20] Takahashi K, Yoshinoya A, Murakami O, Totsune K, Shibahara S. Production and secretion of two vasoactive peptides, adrenomedullin and endothelin-1, by cultured human adrenocortical carcinoma cells. Peptides 2000;21:251-6.
[21] Totsune K, Takahashi K, Ohneda M, Itoi K, Murakami O, Mouri T. C-type natriuretic peptide in the human central nervous system: distribution, and molecular form. Peptides 1994;15:37-40.