Received: 11 November 2020

PART WILEY A

Case report of adrenocortical carcinoma associated with double germline mutations in MSH2 and RET

Margarita Raygada1 Mark Raffeld2

Andrew Bernstein3

Markku Miettinen2

John Glod1 Marybeth S. Hughes4 |

Karlyne Reilly1

Brigitte Widemann1

5 Jaydira Del Rivero İD

1Pediatric Oncology Branch, Center for Cancer Research, National Cancer Institute, Clinical Center, National Institutes of Health, Bethesda, Maryland, DC

2Laboratory of Pathology, National Cancer Institute, Clinical Center, National Institutes of Health, Bethesda, Maryland

3George Washington School of Medicine, George Washington University, Washington, DC

4Department of Surgery, Eastern Virginia Medical School, Norfolk, Virginia

5Developmental Therapeutics Branch, National Cancer Institute, Clinical Center, National Institutes of Health, Bethesda, Maryland

Correspondence

Jaydira Del Rivero, Developmental Therapeutics Branch, National Cancer Institute, Clinical Center, National Institutes of Health, Bethesda, MD, USA.

Email: jaydira.delrivero@nih.gov

Funding information

NCI Cancer Moonshot; Rare Tumor Initiative of the CCR

ABSTRACT

Adrenocortical carcinoma (ACC) is a rare aggressive malignancy that originates in the outer layer of the adrenal gland. Most ACCs are sporadic, but a small percentage of cases are due to hereditary cancer syndromes such as Li-Fraumeni syndrome (LFS), Lynch syndrome (LS), and familial adenomatous polyposis (FAP). Multiple endocrine neoplasia type 2A (MEN2A) is an inherited disorder that predisposes to medullary thyroid cancer, pheochromocytoma, and parathyroid hyperplasia. We present here a case of ACC with both LS and MEN2A; the family and medical history were consis- tent with Lynch. This is, to our knowledge, the first report of a patient with ACC associated with germline mutations in RET and MSH2, and no phenotypical character- istics of MEN2A.

KEYWORDS

adrenocortical cancer, Lynch syndrome, multiple endocrine neoplasia type 2A

|

1 INTRODUCTION

The association of adrenocortical carcinoma (ACC), Lynch syndrome (LS), and multiple endocrine neoplasia type 2A (MEN2A) in the same patient is a novel occurrence. The incidence of ACC alone is less than 0.7-1.5 per 1 million people per year (Kebebew et al., 2006). Most often, ACC occurs sporadically with 5% of cases due to hereditary can- cer syndromes such as Li-Fraumeni syndrome (LFS), familial adenoma- tous polyposis (FAP), and LS (Else et al., 2013; Mazzuco et al., 2012). Despite poor overall survival statistics, recent studies have identified a few long-term survivors, suggesting a more heterogenous prognosis of

ACC (Baudin, 2015). Known prognostic factors include stage at diagno- sis, age, hormone-related symptoms, proliferative index rating (Ki67), Weiss score, and tumor differentiation (Mazzuco et al., 2012).

LS is a heritable cancer syndrome caused by heterozygous germline mutations in mismatch repair genes (MSH2, EpCAM, MLH1, MSH6, and PMS2). LS predisposes to colorectal, endometrial, ovarian, gastric, hepatobiliary, and urinary cancers along with tumors of the small bowel and central nervous system. Some genotype-phenotype correlations have been noted; for example, patients with MSH2 muta- tions carry a higher risk of extracolonic cancers or multiple malignan- cies (Cohen & Leininger, 2014; Lynch et al., 2009).

@ 2021 The Authors. American Journal of Medical Genetics Part A published by Wiley Periodicals LLC.

PART WILEY A

MEN2A is caused by mutations in the RET proto-oncogene and is characterized by predisposition to medullary thyroid cancer (MTC), pheochromocytoma, and parathyroid hyperplasia. There are distinct genotype-phenotype correlation patterns associated with the loca- tion of the mutations which lead to different degrees of penetrance. The diagnosis of MEN2 is suspected in a patient with a germline RET mutation even in the absence of any clinical features (Kloos et al., 2009). The patient described here had the p.Val804Met (Figure 1; low to moderate risk for MTC) mutation in the RET gene.

2 CASE REPORT |

The patient is a G1P1 47-year-old female diagnosed with ACC at 44 years of age. She carried a deleterious germline mutation in the MSH2 gene (c.211+1G>T splice variant; Figure 2) and had a family his- tory of LS. Her clinical presentation and family history were more characteristic of LS at diagnosis; the patient did not have any manifes- tations of MEN2A. She was initially tested for the familial MSH2 vari- ant at 43 years of age, and upon confirmation of positive status, she underwent a preventive complete hysterectomy. Five years after the LS diagnosis, a 12-cm adrenal mass was found on CT scan. The tumor was further subclassified as an ACC with microscopic tumor invasion and lymphovascular extension; the patient was started on mitotane chemotherapy. She has since undergone numerous surgeries for recurrent ACC including right partial hepatectomy, omentectomy, par- tial nephrectomy with excision of tumor, and cytoreductive surgery with hyperthermic intraperitoneal chemotherapy (HIPEC).

She was referred to the National Institutes of Health (NIH) for participation on the Natural History and Biospecimen Acquisition for Children and Adults with Rare Solid Tumors (NCT03739827).

Histopathologic examination from the initial surgery showed a high- grade, poorly differentiated ACC with Ki 67% (Figure 3). Clinical analy- sis of a somatic gene panel of 523 cancer genes (TruSight Oncology 500 (TSO500), Illumina) performed on the patient’s tumor (estimated tumor content of 70%) revealed the presence of a pathogenic muta- tion in the RET gene (c.2410G>A; p.Val804Met) with a VAF of 90%. Due to the high allele frequency of this mutation and the implications of this finding for a possible hereditary cancer condition, confirmatory germline sequencing was performed on the patient’s saliva (GeneDx, Bethesda, MD). The result confirmed that the RET p.Val804Met (c.2410G>T) was present in her germline (heterozygous). In addition, TSO 500 identified the MSH2 c.211+1G>T splice site mutation with a VAF of 88% which is consistent with loss of heterozygosity (LOH). Microsatellite instability was indeterminate in this assay.

The family history was significant for LS on the paternal side (Figure 4). Her father (age of death was 52), paternal grandfather (unknown age of death), and two paternal uncles (unknown age of death) had been diagnosed with colon cancer. The patient’s sister (39 years old) was diagnosed with colon cancer at 28 years of age; she was the initial proband found to have a deleterious germline mutation in the MSH2 gene (c.211+1G>T, IVS1+1G>T). In addition, her paternal half-brother (60 years old), also found to have the familial MSH2 muta- tion, was diagnosed with renal (papillary grade II) cancer, bladder cancer, and primary urethra low-grade carcinoma. The family history was other- wise unremarkable for other cancers or conditions related to mutations in either MSH2 or RET. The patient was counseled on the implications of the germline RET mutation and testing was offered to relatives. Results on her 11-year-old son (asymptomatic, disease free) were negative for both mutations, the patient’s 52-year-old sister (asymptomatic, disease free), as well as all available relatives declined testing. Given the patient’s ACC disease burden, a modified surveillance was recommended.

FIGURE 1 RET mutation identified in the proband (p. Val804Met) [Color figure can be viewed at wileyonlinelibrary.com]

43,614,990 bp I

43,615,000 bp

I

I

I

I

A

A

A

A

A

A

A

A

A

A

A

A

A

A

CTCCTCCTCATCGTGGAGTACGCCA

L

L

L

I

V

E

Y

A

RET

A

47,630,540 bp

1

FIGURE 2 MSH2 mutation identified in the proband (c.211 +1G>T) [Color figure can be viewed at wileyonlinelibrary.com]

T

T

T

T

T

T

T

T

T

T

T

T

T

T

T

CA

T

C

G G

GC CC

G

G

H

G G

A

G

G

G

C

C

G

G

G

A

C

G

G

Y

M

G

P

A

G

MSH2

FIGURE 3 Adrenocortical carcinoma is composed of sheets of large epithelioid cells with pale to eosinophilic cytoplasm and nuclear pleomorphism (magnification 200x) [Color figure can be viewed at wileyonlinelibrary.com]

|

3 DISCUSSION

We describe here the case of a 47-year-old female with metastatic ACC, and a deleterious germline mutation in two cancer predisposing genes (RET and MSH2); the patient was referred to the NIH without prior knowledge of her RET status.

The association of ACC and LS was initially described by Raymond et al., 2013, who reported that 3.2% of LS patients had ACC (Raymond et al., 2013). In 2016 Challis et al. reported the first case of familial ACC in association with an MSH2 pathogenic mutation (Challis et al., 2016). These studies advocate for the inclusion of ACC in the

clinical diagnostic criteria of LS and for increased surveillance in LS patients at risk for ACC; an argument fortified by the present case which showed biallelic inactivation of MSH2 in an ACC tumor of a patient with Lynch.

The family history of this patient was significant for colorectal cancer in four paternal relatives. In addition, the patient’s sister was diagnosed with colorectal cancer at 28 years of age, and her paternal half-brother developed kidney and bladder cancer. Both siblings were carriers of the familial MSH2 mutation. Genotype-phenotype correla- tions in the c.211+1G>T mutation have not been identified to date. In general, MSH2 mutations are associated with 48% risk of colorectal cancer, 21% risk of endometrial cancer, and 24% ovarian cancer; the risk of any cancer with MSH2 mutations range from 14.3% by age of 40 to 80.4% by age of 75 (Pérez-Cabornero et al., 2013). A four- generation pedigree (Figure 4) did not reveal any additional cancers, which is consistent with the incomplete penetrance and variable expression seen in MSH2 pathogenic variants.

Upon enrollment in the NIH protocol (NCT03739827), the patient’s tumor was found to be positive for the pathogenic RET mutation (c.2410G>A, p.Val804Met) with an allele fraction (VAF) of 90% (tumor content 70%). The high VAF was likely due to LOH at the RET locus as has been reported previously by several studies looking at the somatic mutation profile of the RET gene in MTC (Dvorakova et al., 2006; Quadro et al., 2001). Germline testing was performed; the results confirmed the presence of this mutation in her germline (heterozygous); the patient was counseled about the clinical predispo- sitions associated with this finding.

In the past two decades, since the discovery of the RET gene, sub- stantial evidence has emerged delineating genotype-phenotype cor- relations of this gene (e.g., calcitonin level variations with different

FIGURE 4 Four-generation family history pedigree [Color figure can be viewed at wileyonlinelibrary.com]

92 Colon 91

COLON

Skin CA Diabetes

50

52 MSH2 (not tested) COLON

73

Alcoholism

MSH2 (not tested) Fatty Liver

8 Drowned

COLON

COLON

Heart problems

Dementia

Heart and Kidney Disease

2

2

Thyroid “problems” MSH2 (-)

45

44 MSH2 + RET +

46 MSH2+ Polyps removed

60

53 Thyroid nodules

42 MSH2 (not tested)

39 MSH2 + COLON 28

ACC

Kidney Bladder MSH2 +

Complete hysterectomy (preventive) Breast Reduction (cosmetic)

8

20

MSH2 (-)

25

12

22

23

12 MSH2 (-)

MSH2 +

RENAL CANCER

COLON

BLADDER CANCER

SKIN CA (unknown type)

ACC

codons). The p. Val804Met mutation is one of the most common mutations in the RET gene; the American Thyroid Association (ATA) classifies this mutation as moderate risk in the guidelines for the man- agement of MTC (Loveday et al., 2008; Møller et al., 2017; Romei et al., 2016). This variant has received significant attention because of its variable age-related penetrance and clinical heterogeneity (Feldman et al., 2000; Frohnauer & Decker, 2000; İmge Aydoğan et al., 2016; Learoyd et al., 2005; Rich et al., 2014; Wells et al., 2015). The manifestation of disease from carriers of the p.Val804Met muta- tion ranges from metastatic MTC at an early age to no evidence of disease by age 80 (Feldman et al., 2000; Wells et al., 2015) and includes several reports of pheochromocytoma (Høie et al., 2000; Nilsson et al., 1999), papillary thyroid carcinoma (Brauckhoff et al., 2002; Gibelin et al., 2004), and concomitant papillary and med- ullary carcinoma (Shifrin et al., 2009). The patient discussed here had no manifestation of RET-related conditions, as evidenced by normal levels of plasma metanephrines, calcitonin, and carcinoembryonic anti- gen (CEA) on evaluation. At the time of referral, she presented with metastatic lesions in the liver and retroperitoneal soft-tissue nodules. Therefore, the management of the complications associated with the presence of a germline mutation in the RET gene was modified to a less invasive protocol. Recommendations for her surveillance included yearly metanephrines and calcitonin labs with an annual thyroid ultra- sound. The patient’s 11-year-old son tested negative for both muta- tions. Given that no other family members agreed to germline genetic testing of the RET mutation, the possibility of a de novo mutation can- not be ruled out.

Tumor panel sequencing in cancer patients is now part of the standard of care in most clinical settings. Therefore, secondary germline findings from tumor profiling have become more common in recent years. Approximately 2.3%-12% adult cancer patients have actionable germline pathogenic variants detected from tumor panels (Mandelker & Zhang, 2018; Schrader et al., 2016; Seifert et al., 2016);

similar findings have been reported in the pediatric population with numbers ranging from 8.5% to 10% (Meric-Bernstam et al., 2016). These findings are usually unexpected, given that the main focus of tumor profiling is identification of potential targets for therapy or fur- ther characterization of the tumor. However, germline pathogenic var- iants can be inferred from tumor-only testing (as opposed to tumor- normal testing) but must be confirmed with follow-up germline test- ing. The patient’s clinical presentation and family history were consis- tent with LS only, and she did not meet criteria for MEN2A testing; thus, the possibility of a second hereditary cancer syndrome was extremely low. This case highlights the importance of performing con- firmatory germline testing, even when the likelihood of a second underlying cancer predisposition syndrome is low.

Additionally, this case exemplifies the importance of including genetic counselors as part of a multidisciplinary team that manages patients undergoing tumor genomic testing. The confirmation of a secondary germline cancer-predisposing mutation generated signifi- cant anxiety in this patient, mostly due to concerns for her son. How- ever, through discussion with a genetic counselor she understood the benefits of early testing in asymptomatic relatives, who can then undergo tailored cancer surveillance and choose from available pre- ventative options.

|

4 CONCLUSIONS

We report a rare case of the co-occurrence of two hereditary cancer syndromes, LS and MEN2A, in a metastatic ACC patient with a clinical presentation and family history suggestive only of LS. The presence of the second germline mutation was inferred from a tumor somatic panel and confirmed by germline testing; management recommenda- tions were implemented for the patient, and additional testing was offered to relatives. The clinical consequences of these two

A

pathogenic germline mutations have not been reported before; at this time, it is too early to speculate on possible synergistic or modifier effects of the co-occurrence. Future studies will focus on the long- term outcomes of these family members.

ACKNOWLEDGMENTS

The research reported in this publication was supported by the Rare Tumor Initiative of the CCR and by the NCI Cancer Moonshot.

CONFLICT OF INTEREST

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

AUTHOR CONTRIBUTIONS

All authors participated in the conception and design of the study. All authors have given their approval of the final version of the manu- script and take responsibility for the manuscript’s content and accuracy.

ORCID

Jaydira Del Rivero D https://orcid.org/0000-0001-9710-4030

REFERENCES

Baudin, E. (2015). Adrenocortical carcinoma. Endocrinology and Metabolism Clinics of North America, 44(2), 411-434. https://doi.org/10.1016/j. ecl.2015.03.001

Brauckhoff, M., Gimm, O., Hinze, R., Ukkat, J., Brauckhoff, K., & Dralle, H. (2002). Papillary thyroid carcinoma in patients with RET proto- oncogene germline mutation. Thyroid, 12(7), 557-561. https://doi.org/ 10.1089/105072502320288393

Challis, B. G., Kandasamy, N., Powlson, A. S., Koulouri, O., Annamalai, A. K., Happerield, L., … Gurnell, M. (2016). Familial adreno- cortical carcinoma in association with Lynch syndrome. Journal of Clini- cal Endocrinology & Metabolism, 101(6), 2269-2272. https://doi.org/ 10.1210/jc.2016-1460

Cohen, S., & Leininger, A. (2014). The genetic basis of Lynch syndrome and its implications for clinical practice and risk management. Application of Clinical Genetics, 7, 147-158. https://doi.org/10.2147/tacg.s51483

Dvorakova, S., Vaclavikova, E., Sykorova, V., Duskova, P., Vlcek, P., Novak, Z., & Bendlova, B. (2006). New multiple somatic mutations in the RET proto-oncogene associated with a sporadic medullary thyroid carcinoma. Thyroid, 16, 311-316. https://doi.org/10.1089/thy.2006. 16.311

Else, T., Kim, A. C., Sabolch, A., Raymond, V. M., Kandathil, A., Caoili, E. M., … Hammer, G. D. (2013). Adrenocortical carcinoma. Endocrine Reviews, 35(2), 282-326. https://doi.org/10.1210/er.2013-1029

Feldman, G. L., Edmonds, M. W., Ainsworth, P. J., Schuffenecker, I., Lenoir, G. M., Saxe, A. W., … Jackson, C. E. (2000). Variable expressiv- ity of familial medullary thyroid carcinoma (FMTC) due to a RET V804M (GTG-+ATG) mutation. Surgery, 128(1), 93-98. https://doi. org/10.1067/msy.2000.107103

Frohnauer, M. K., & Decker, R. A. (2000). Update on the MEN 2A c804 RET mutation: Is prophylactic thyroidectomy indicated? Surgery, 128 (6), 1052-1058. https://doi.org/10.1067/msy.2000.11/6/111080

Gibelin, H., Bezieau, S., Misso, C., Bouin-Pineau, M .- H., Maréchaud, R., & Kraimps, J .- L. (2004). GermlineRETV804M mutation associated with multiple endocrine neoplasia type 2A. British Journal of Surgery, 91(11), 1458-1459. https://doi.org/10.1002/bjs.4718

Høie, J., Heimdal, K., Nesland, J. M., & Børmer, O. (2000). Prophylactic thy- roidectomy in carriers of RET oncogene mutation carriers. Tidsskrift for

den Norske laegeforening: tidsskrift for praktisk medicin, ny raekke, 120 (27), 3249-3252.

İmge Aydoğan, B., Yüksel, B., Tuna, M. M., Basaran, M. N., Kocaeli, A. A., Ertorer, M. E., … Erdogan, M. F. (2016). Distribution of RET mutations and evaluation of treatment approaches in hereditary medullary thy- roid carcinoma in Turkey. Journal of Clinical Research in Pediatric Endo- crinology, 8(1), 13-20. https://doi.org/10.4274/jcrpe.2219

Kebebew, E., Reiff, E., Duh, Q .- Y., Clark, O. H., & McMillan, A. (2006). Extent of disease at presentation and outcome for adrenocortical car- cinoma: Have we made progress? World Journal of Surgery, 30(5), 872-878. https://doi.org/10.1007/s00268-005-0329-x

Kloos, R. T., Eng, C., Evans, D. B., Francis, G. L., Gagel, R. F., Moley, J. F., … Wells, S. A., Jr. (2009). Medullary thyroid cancer: Management guide- lines of the American Thyroid Association. Thyroid, 19(6), 565-612.

Learoyd, D. L., Gosnell, J., Elston, M. S., Saurine, T. J., Richardson, A. N., Delbridge, L. W., … Robinson, B. G. (2005). Experience of prophylactic thyroidectomy in multiple endocrine neoplasia type 2A kindreds with RET codon 804 mutations. Clinical Endocrinology, 63(6), 636-641. https://doi.org/10.1111/j.1365-2265

Loveday, C., Josephs, K., Chubb, D., Gunning, A., Izatt, L., Tischkowitz, M., … Turnbull, C. (2008). p.Val804Met, the most frequent pathogenic mutation in RET, confers a very low lifetime risk of medullary thyroid cancer. Journal of Clinical Endocrinology & Metabolism, 103(11), 4275-4282. https://doi.org/10.1210/jc.2017-02529

Lynch, H., Lynch, P., Lanspa, S., Snyder, C., Lynch, J., & Boland, C. (2009). Review of the Lynch syndrome: History, molecular genetics, screening, differential diagnosis, and medicolegal ramifications. Clinical Genetics, 76(1), 1-18. https://doi.org/10.1111/j.1399-0004.2009.01230.x

Mandelker, D., & Zhang, L. (2018). The emerging significance of secondary germline testing in cancer genomics. Journal of Pathology, 244(5), 610-615. https://doi.org/10.1002/path.5031

Mazzuco, T. L., Durand, J., Chapman, A., Crespigio, J., & Bourdeau, I. (2012). Genetic aspects of adrenocortical tumours and hyperplasias. Clinical Endocrinology, 77(1), 1-10. https://doi.org/10.1111/j.1365- 2265.2012.04403.x

Meric-Bernstam, F., Brusco, L., Daniels, M., Wathoo, C., Bailey, A. M., Strong, L., … Chen, K. (2016). Incidental germline variants in 1000 advanced cancers on a prospective somatic genomic profiling protocol. Annals of Oncology, 27(5), 795-800. https://doi.org/10.1093/annonc/ mdw018

Møller, P., Seppälä, T. T., Bernstein, I., Holinski-Feder, E., Sala, P., Evans, D. G., … Mallorca Group. (2017). Cancer risk and survival in path_MMR carriers by gene and gender up to 75 years of age: A report from the prospective Lynch syndrome database. Gut, 67(7), 1306-1316. https://doi.org/10.1136/gutjnl-2017-314057

Nilsson, O., Tisell, L. E., Jansson, S., Ahlman, H., Gimm, O., & Eng, C. (1999). Adrenal and extra-adrenal pheochromocytomas in a family with germline RET V804L mutation. JAMA, 281(17), 1587-1588. https://doi.org/10.1001/jama.281.17.1587

Pérez-Cabornero, L., Infante, M., Velasco, E., Lastra, E., Miner, C., & Duran, M. (2013). Genotype-phenotype correlation in MMR mutation- positive families with Lynch syndrome. International Journal of Colorec- tal Disease, 28(9), 1195-1201. https://doi.org/10.1007/s00384-013- 1685

Quadro, L., Fattoruso, O., Cosma, M. P., Verga, A., Porcellini, A., Libroia, A., & Colantuoni, V. (2001). Loss of heterozygosity at the RET protooncogene locus in a case of multiple endocrine neoplasia type 2A. Journal of Clinical Endocrinology & Metabolism, 86(1), 239-244. https://doi.org/10.1210/jcem.86.1.7144

Raymond, V. M., Everett, J. N., Furtado, L. V., Gustafson, S. L., Junbluth, C. R., Gruber, S. B., … Else, T. (2013). Adrenocortical carci- noma is a Lynch syndrome-associated cancer. Journal of Clinical Oncol- ogy, 31(24), 3012-3018. https://doi.org/10.1200/jco.2012.48.0988

Rich, T. A., Feng, L., Busaidy, N., Cote, G. J., Gagel, R. F., Hu, M., … Grubbs, E. (2014). Prevalence by age and predictors of medullary

A

thyroid cancer in patients with lower risk germline RET proto- oncogene mutations. Thyroid, 24(7), 1096-1106. https://doi.org/10. 1089/thy.2013.0620

Romei, C., Ciampi, R., & Elisei, R. (2016). A comprehensive overview of the role of the RET proto-oncogene in thyroid carcinoma. Nature Reviews Endocrinology, 12(4), 192-202. https://doi.org/10.1038/nrendo. 2016.11

Schrader, K. A., Cheng, D. T., Joseph, V., Prasad, M., Walsh, M., Zehir, A., … Robson, M. (2016). Germline variants in targeted tumor sequencing using matched normal DNA. JAMA Oncology, 2(1), 104-111. https:// doi.org/10.1001/jamaoncol.2015.5208

Seifert, B. A., O’Daniel, J. M., Amin, K., Marchuk, D. S., Patel, N. M., Parker, J. S., … Berg, J. S. (2016). Germline analysis from tumor- germline sequencing dyads to identify clinically actionable secondary findings. Clinical Cancer Research, 22(16), 4087-4094. https://doi.org/ 10.1158/1078-0432.ccr-16-0015

Shifrin, A. L., Xenachis, C., Fay, A., Matulewicz, T. J., Kuo, Y .- H., & Vernick, J. J. (2009). One hundred and seven family members with the

rearranged during transfection V804M proto-oncogene mutation pre- senting with simultaneous medullary and papillary thyroid carcinomas, rare primary hyperparathyroidism, and no pheochromocytomas: Is this a new syndrome-MEN 2C? Surgery, 146(6), 998-1005. https://doi. org/10.1016/j.surg.2009.09.021

Wells, S. A., Asa, S. L., Dralle, H., Elisei, R., Evans, D. B., Gagel, R. F., … Waguespack, S. G. (2015). Revised American Thyroid Association guidelines for the management of medullary thyroid carcinoma. Thy- roid, 25(6), 567-610. https://doi.org/10.1089/thy.2014.0335

How to cite this article: Raygada M, Raffeld M, Bernstein A, et al. Case report of adrenocortical carcinoma associated with double germline mutations in MSH2 and RET. Am J Med Genet Part A. 2021;185A:1282-1287. https://doi.org/10.1002/ ajmg.a.62099