MEDICINE
☐ CASE REPORT ☐
Feminizing Adrenocortical Carcinoma with Distinct Histopathological Findings
Masako Hatano1, Yasuhiro Takenaka’, Ikuo Inoue’, Keiko Homma2, Tomonobu Hasegawa3, Hisanobu Sasano4, Takuya Awata1 and Shigehiro Katayama1
Abstract
We herein present a 60-year-old man with adrenocortical carcinoma who had gynecomastia. An endocri- nological examination revealed increased levels of serum estradiol and dehydroepiandrosterone-sulfate (DHEA-S) and reduced levels of free testosterone. Magnetic resonance imaging showed an adrenal tumor with heterogeneous intensity. Iodine-131 adosterol scintigraphy showed an increased uptake at the same site. Because feminizing adrenocortical carcinoma was suspected, right adrenalectomy was performed; the patho- logical diagnosis was adrenocortical carcinoma. The results of immunostaining indicated a virilizing tumor. Aromatase activity was identified on RT-PCR. As disorganized steroidogenesis is pathologically present in adrenocortical carcinoma, this diagnosis should be made with caution.
Key words: adrenocortical carcinoma, aromatase, estrogen-producing tumor, gynecomastia, testosterone
(Intern Med 55: 3301-3307, 2016) (DOI: 10.2169/internalmedicine.55.5912)
Introduction
Adrenocortical carcinomas are rare tumors, with estrogen- producing feminizing adrenocortical carcinomas being even rarer among hormone-producing tumors, with an incidence of 2% among all adrenocortical carcinomas (1, 2). A normal adrenal gland has little aromatase activity (aromatase con- verts androgen to estrogen). In contrast, in feminizing adrenocortical carcinoma, oncogenesis leads to aromatase expression and induces estrogen synthesis, resulting in feminization in men.
We herein present a case of feminizing adrenocortical car- cinoma that was clinically an estrogen-producing tumor and pathologically a testosterone-producing tumor.
This study design was approved by our hospital ethics committee, and informed consent was obtained from the pa- tient.
Real-time quantitative RT-PCR was performed with the use of fluorescence SYBR green technology (Light Cycler; Roche Molecular Biochemics, Manheim, Germany), and
quantitative measurement of P450 aromatase was performed. Total RNA was extracted from the excised tumor, and cDNA was quantitated. The PCR primers used are shown in Table 1. Real-time quantitative RT-PCR was also performed for a control group including the ovaries, normal adrenal cortex, and adrenal cortex obtained from patients with Cush- ing syndrome and the adrenal medulla obtained from pheo- chromocytoma.
Case Report
A 60-year-old man presented with a 3-year history of gy- necomastia and right hypochondriac pain. He visited a phy- sician and received famotidine treatment with a diagnosis of gastroenteritis, without relief. The following year, he visited another physician, was found to have a 13 cm right adrenal tumor on abdominal computed tomography (CT), and was referred to our center. At presentation, his body height was 163.7 cm, body weight was 70.7 kg, and body mass index was 26.4 kg/m2. His blood pressure was 110/60 mmHg and pulse rate was 64 beats per minute, which were normal.
Department of Endocrinology and Diabetes, Saitama Medical University, Japan, 2Central Clinical Laboratories, Keio University Hospital, Japan,
3Department of Pediatrics, Keio University School of Medicine, Japan and 4Department of Pathology, Tohoku University Graduate School of Medicine, Japan
Correspondence to Dr. Masako Hatano, pata@saitama-med.ac.jp
| Sense | Antisense | |
|---|---|---|
| Exon II-III coding region | GACTCTAAATTGCCCCCTCTG | CAGAGATCCAGACTCGCATGA |
| Exon I.3-specific | CCTTGTTTTGACTTGTAACCA | CAGAGATCCAGACTCGCATGA |
| Promoter II-specific | AACAGGAGCTATAGATGAAC | CAGAGATCCAGACTCGCATGA |
| pre | post | reference ranges | |
|---|---|---|---|
| ACTH (pg/mL) | 8.7 | 25.6 | 7.2 - 63.3 |
| Cortisole (µg/dL) | 10.3 | 13.1 | 2.3 - 19.4 |
| DHEA-S (ug/dL) | 560 | 42 | 38.0 - 313.0 |
| Estradiol (pg/mL) | 284 | 17 | 15.0 - 35.0 |
| F-testosterone (pg/mL) | <0.6 | 0.257 | 5.4 - 16.7 |
| LH (mIU/mL) | 0.1 | 3.6 | 2.2 - 8.4 |
| FSH (mIU/mL) | 0.2 | 5.4 | 1.8- 12.0 |
| PRA (ng/mL-hr) | 1.1 | 0.7 | 0.3 - 2.9 |
| Aldosterone (pg/mL) | 110.0 | 37.4 | 35.7 - 240.0 |
| urinary metabolites(Ms) | pre | post | reference ranges |
|---|---|---|---|
| Σpregnenolone Ms1) | 18.858 | 0.026 | 0.097 - 0.422 |
| progesterone M2) | 3.223 | 0.151 | 0.084 - 0.371 |
| DOC M3) | 0.016 | 0.004 | 0.002 - 0.007 |
| Ecorticosterone Ms4) | 0.074 | 0.257 | 0.206 - 0.646 |
| aldosterone M5) | 0.012 | 0.010 | 0.003 - 0.026 |
| Σ170Ηpregnenolone Ms6) | 65.045 | 0.163 | 0.049 - 0.246 |
| Σ170Ηprogesteone Ms7) | 9.745 | 0.585 | 0.333 - 1.272 |
| 11-deoxycortisol M8) | 1.990 | 0.075 | 0.035 - 0.198 |
| Ecortisol Ms9) | 9.120 | 6.183 | 4.739 - 11.343 |
| EDHEA Ms10) | 65.092 | 0.380 | 0.065 - 1.313 |
| Eandrostenedione Ms11) | 5.492 | 1.209 | 0.751 - 2.583 |
| Eestrogen Ms12) | 0.955 | 0.001 | 0.001 - 0.015 |
1) pregnenolone,3฿,20a-pregnenediol, 2) 3a,20a-pregnanediol, 3) tetrahydro-11-deoxycorticosterone, 4) 5ß-tetrahydrocorticosterone, 5a- tetrahydrocorticosterone, 5ß-tetrahydro-11-dehydrocorticosterone, 5a- tetrahydro-11-dehydrocorticosterone, 5) 5ß-tetrahydroaldosterone, 6) 17a-hydroxypregnenolone, 36,17a,20a-pregnenetriol, 7) 56-17a- hydroxypregnanolone, 5a-17a-hydroxypregnanolone, 50-3a,17a,20ß- pregnanetriol,5-3a,17a,20a-pregnanetriol, 5a-3a,17a,20a-pregnanetriol, 8) 5ß-tetrahydro-11-deoxycortisol, 9) cortisol, 66-hydroxycortisol, 5ß- tetrahydrocortisol, 5a-tetrahydrocortisol, 20a-cortol, 20ß-cortol, 20a- dihydrocortisol, 20ß-dihydrocortisol, cortisone, 5ß-tetrahydrocortisone, 5a-tetrahydrocortisone, 20a-cortolone, 20-cortolone, 5a-200-cortolone, 20a-dihydrocortisone, 20ß-dihydrocortisone, 10) DHEA, 36,17ß- androstenediol, 16a-hydroxy-DHEA, 16ß-hydroxy-DHEA, 16-oxo- androstenediol, 36,16a-17ß-androstenetriol, 11) androsterone, etiocholanolone, 12) estrone, estradiol, estriol.
| 8:00 | 14:00 | 23:00 | 1 mg | 8 mg | |
|---|---|---|---|---|---|
| ACTH (pg/mL) | 8.7 | 10.1 | 2.5 | <2.0 | <2.0 |
| Cortisol (µg/dL) | 10.3 | 6.9 | 6.2 | 7.9 | 7.3 |
There were no abnormalities in his breath or heart sounds. Palpation revealed a tumor in the right hypochondriac re- gion, but no superficial lymph nodes. The patient did not have any Cushingoid features such as moon face, central obesity, or buffalo hump. A gynecomastia was detected in the breast, corresponding to Tanner developmental stage 2 with concomitant libido decrement. There was no notable medical history, however, the patient’s mother had valvular heart disease. He drank socially and never smoked.
The complete blood cell count was within the normal range. There were no abnormalities in the levels of electro- lytes or blood glucose. An endocrinological examination re- vealed elevated levels of DHEA-S and estradiol, and re- duced levels of testosterone, LH, and FSH (Table 2). Con- sidering the hypothalamusry-adrenal axis, the circa- dian rhythm of cortisol was lost, and no cortisol suppression was identified on the low-dose (1 mg) and high-dose (8 mg) dexamethasone suppression tests (Table 3).
The corticosteroid profile from 24-hour urine collection (Table 4) revealed increased levels of pregnenolone, proges- terone, deoxycorticosterone, 17-hydroxyprogesterone, an- drostenedione, and estrogen, suggesting an adrenal tumor with reduced activity of 3ß-hydroxysteroid dehydrogenase (3ß-HSD) and 11-ß-hydroxylase.
Abdominal CT and magnetic resonance imaging showed a massive tumor, measuring 16x11×14 cm in size, suggesting an intratumoral hemorrhage and necrosis. There was no ra- diological evidence indicating metastasis to the liver, right kidney, or surrounding tissue. Iodine-131 adosterol scintigra- phy revealed an uptake at the site corresponding to the right adrenal gland and suppression on the left side (Fig. 1).
Adrenocortical carcinoma was suspected according to the endocrinological and imaging studies, and right adrenalec- tomy was performed. After surgery, the blood levels of es- tradiol and DHEA-S were reduced, and levels of free testos- terone were elevated (Table 2). The urinary steroid profile was improved (Table 4).
Postsurgical adjuvant therapy was not performed, because of the patient’s refusal, until 11 months after surgery, when metastases to the locoregional lymph nodes and peritoneum and increased levels of estradiol were observed. In addition,
a
b
c
d
e
A
N
V
D
P
the fluorodeoxyglucose uptake was shown on fluorodeoxyglucose-positron emission tomography at the lo- coregional lymph nodes and peritoneum. Mitotane (o,p’- DDD) was orally administered according to the diagnosis of metastases. After the initiation of oral mitotane, the metas- tatic lesions shrunk and the estradiol level decreased. Treat- ment with etoposide, doxorubicin, and cisplatin (i.e., the EDP regimen) is planned in the case of tumor regrowth.
Pathology
The resected tumor measured 13x12 cm in diameter and was yellow-tan in color. On pathological examination, a solid tumor was found adjacent to the normal adrenal gland, with cellular atypia. A thick capsule was present at the rim of the tumor. The tumor included cellular components with a clear cytoplasm forming a“Zellballen”structure, and cells with eosinophilic abundant cytoplasm were associated with the thin fibrotic vascular interstitium (p0, T2, N0, M0) (Fig. 2).
As shown in Fig. 2, the tumor satisfied seven of nine items in the Weiss criteria: (1) nuclear atypia, (2) mitosis, (3) capsular invasion, (4) confluent necrosis, (5) cytoplasm, (6) architecture, and (7) sinusoidal invasion, indicating that the adrenal tumor might be malignant. The adrenal tissue was positive for SF-1, suggesting that the tumor originated from the adrenal cortex. The Ki67-labeling index was 18% in the hot spot, indicating an extremely high-grade malig-
nant tumor. Regarding steroidogenic enzymes, a disorgan- ized steroidogenesis pattern was observed, without the ex- pression of aromatase, 17-ß hydroxysteroid dehydrogenase 1 (17-B-HSD1), STS, or 5-alpha-reductase 1 in most tumor cells, and with the expression of STS 5-alpha-reductase 2 in some parts of the tumor cells. The diffuse expression of 17- ß hydroxysteroid dehydrogenase 5(17-B-HSD5) was present in the tumor, pathologically indicating a testosterone- producing tumor (Fig. 3).
RT-PCR
Real-time quantitative RT-PCR for exons was performed to identify the expression of exon II, promoter II, and exon I.3 (Fig. 4). In the tested ovary, the expression of exon II, promoter II, and exon I.3 was positive. Laboratory samples from the control group, including the normal adrenal cortex, and those obtained from patients with Cushing syndrome were weakly positive. The tested pheochromocytoma was negative. In contrast, samples from the patient showed mRNA levels higher than that of the control group.
In addition, upon measuring the actual steroid production of the adrenocortical carcinoma tissue, the estrogen level was relatively higher than the testosterone level (Table 5).
Therefore, adrenocortical carcinoma in this patient was considered to have an aromatase activity.
SF-1
Ki67
50 gr
aromatase
17₿HSD1
STS
50 g/m
50 pm
5a-reductase1
5a-reductase2
17₿HSD5
Discussion
Adrenocortical carcinoma is a rare tumor with an inci- dence of 0.5-2 cases per million persons, while accounting for only approximately 0.2% of total cancer deaths (2-5).
Adrenocortical carcinoma is classified into hormonally
functional and nonfunctional tumors, and approximately 60% of patients have clinical symptoms caused by excessive steroidenesis (6). Major symptoms with excessive hormone secretion include Cushing syndrome due to excess cortisol (50%), virilization due to excessive androgen (34%), and the combination thereof (11%); however, feminization is rare (2- 6%) (7, 8).
Relative RNA expression
300
200
100-
6420
eII pII eI.3
eII pII eI.3
eII pII eI.3
eII pII eI.3
eII pII eI.3
Normal adrenal cortex
Pheochromo- cytoma
Cushing synd.
This case
Ovary
P450scc
P450c17
Pregnenolone (4.87 µg/g)
17-hydroxy- pregnenolone (1.77µg/g)
DHEA-S (1.59µg/g)
P450c17
DHEA (188.13 ng/g)
3฿HSD
Progesterone (7.31 ng/g)
17-hydroxy- progesterone (100.16 ng/g)
androstendione (43.10 ng/g)
P450c21
17₿HSD
Deoxycoticosterone (2.54 ng/g)
11-deoxycortisol (107.44 ng/g)
testosterone (8.12 ng/g)
P450c11
P450aroma
corticosterone (1.67 ng/g)
cortisol (69.79 ng/g)
Estradiol (12.47 ng/g)
P450ald
18-hydroxycorticosterone
aldosterone (0.18 ng/g)
Two possible mechanisms have been reported by which the blood level of estrogen is elevated in feminizing adreno- cortical carcinoma. Androgen is converted to estrogen by aromatase. Aromatase is highly expressed in granular layer cells of the developing follicle and syncytium cells of the placenta, and there is very little aromatase activity in the normal adrenal gland (9). Therefore, androgen produced in adrenal carcinoma was previously considered to be con- verted to estrogen in the peripheral tissues including adipose tissues (10). This is similar to the fact that when high doses of anabolic steroids are administered to men, the conversion of excessive androgen to estrogen is promoted in the periph- eral tissues, leading to gynecomastia (11, 12), as reported in
doping cases. However, in recent years, aromatase activity has been reported in feminizing adrenocortical carcinoma, and a study showed that the adrenal tumor itself converts androgen to estrogen (13). Normally, the aromatase expres- sion in human tissues is partially regulated by tissue-specific promoters. They are known to be located in exon I.1 in the placenta, exon I.3 and promoter II in the ovaries, and pro- moter I.4 in adipose tissues (9). However, some studies have shown that the tumor cells of feminizing adrenocortical car- cinoma have exon II, promoter II, and exon I.3 and aromatase activity and show intratumoral estrogen produc- tion (14, 15). Advani et al. described the presence of pro- moter II in feminizing adrenocortical caricoma (16).
Preoperative urinary steroid profiling revealed reduced levels of decreased 3ß-HSD in addition to decreased 11ß- hydroxylase.
In general, if the activity of 30-HSD decreases, then transformation from DHEA to androstenedione becomes dif- ficult, and consequently the estrogen production decreases.
However, since progesterone, 17-OH progesterone and an- drostenedione levels were high, and pregnenolone, 17-OH pregnenolone and DHEA levels were also abnormally high, we speculated that this patient did not have sufficient 3ß- HSD amounts to metabolize to progesterone, 17-OH proges- terone or androstenedione in a proportion similar to normal adrenal gland. That is, it was thought to indicate a relatively low 3ß-HSD activity.
In addition, according to the fact that the levels of me- tabolites of androstenedione were twice the reference range upper limit and a high concentration of estrogen was also found, we speculated that 3ß-HSD produced substantial an- drostenedione metabolites, and was further metabolized to estrogen.
Furthermore, in addition to a decrease in activity of 21- hydroxylase in feminizing adrenocortical carcinoma, a de- crease in the activity of 11ß-hydroxylase has been noted (17-19).
According to the above findings, we suspected estrogen- producing feminizing adrenocortical carcinoma in this pa- tient. In contrast, no aromatase expression was observed in the adrenal tissue according to the pathological findings, while the expression of 17ßHSD5 was observed.
Hence, this patient was diagnosed with a testosterone- secreting tumor. Furthermore, these findings raised the pos- sibility that excessive androgen produced in adrenocortical carcinoma was metabolized to estrogen in the peripheral tis- sues.
Due to the discrepancy between the clinical and histopa- thological data, we examined the presence of mRNA for aromatase in the adrenal tumor by RT-PCR in order to con- firm the conversion to estrogen in adrenocortical carcinoma. RT-PCR revealed the expression of promoter II and exon I.3 in the patient’s adrenocortical carcinoma. Therefore, estro- gen production was suspected in adrenocortical carcinoma of this patient.
In addition, as shown in Table 5, intratumoral steroids re- vealed a relatively higher level of estrogen than testosterone. Moreover, when examining the aromatase activity in tissues, the stable isotope 13C3-T was used as the substrate and pu- rified 13C3-E2 was quantified in order to distinguish the originally present endogenous E2.
Incubation of 500 ng of 13C3-T with 25.4 mg equivalent weight of tissue homogenate at 37℃ for 2 hours (2 mg of NADPH added) was found to form 430.16 pg of 13C3-E2.
This, on converting to per gram of tissue weight, becomes 16.935 ng/g.
When the said measurement conditions are used, the amount of 13C-E2 formed corresponds to about 100 ng/g in rat ovary and about several dozen pg/g in human fat, which
is known to have an aromatase activity.
Additionally, when tissue devoid of any aromatase activity is used, it is below the quantification limit.
Therefore, this value of 16.935 ng/g is considered to con- firm a fairly strong aromatase activity, although it is some- what less than that of the at ovary.
For the pathological analysis, we used immunohistochem- istry to analyze the expression pattern of steroidogenic en- zymes. This method is used to show elevated synthesis/se- cretion of steroid hormones in the adrenal cortex (20).
In adrenocortical adenomas, due to the systematic expres- sion of steroidogenic enzymes, a homogeneous expression of steroidogenic enzymes is observed on immunohistochem- istry. In contrast, in adrenocortical carcinomas, enzymes are heterogeneously expressed and various intermediate metabo- lites are secreted. Thus, on immunohistochemistry, all the steroidogenic enzymes are not homogeneously expressed in cells from adrenocortical carcinoma, but the differential ex- pression of 3ß-HSD, P450-HSD, and DHEAS-T is ob- served (13, 20). This heterogeneous expression of steroido- genic enzymes is referred to as“steroid disorganiza- tion” (21). Sasano et al. reported a case of adrenocortical carcinoma with Cushing syndrome, but were unable to de- tect steroidogenic enzymes on immunohistochemistry (22). Another study showed that, even among the cases of adreno- cortical carcinoma expressing the same steroidogenic en- zymes, the blood/urinary steroid profiles varied in each case. Some cases of adrenocortical carcinoma do not result in clinical symptom even if steroids are synthesized, in which each tumor cell synthesizes steroids at levels below the measurement sensitivity. This type of steroid-producing tu- mor sometimes exhibits symptoms as the tumor becomes larger (1, 22), which is known to result from the heterogene- ous expression of steroidogenic enzymes in the cells of adrenocortical carcinoma. Because immunohistochemistry is incapable of detecting all tumor cells, the expression of ste- roidogenic enzymes differs at the protein and mRNA lev- els (22), i.e., in some cases, even if aromatase is negative on the pathological analysis, immunohistochemistry may not detect it when each cell expresses a very small amount. Thus, immunohistochemistry does not detect all the cells of adrenocortical carcinoma, which may lead to a discrepancy between the results of immunohistochemistry and the clini- cal features. Hence, the expression of steroidogenic enzymes differs from the clinical features depending on the portion of the tumor analyzed by immunohistochemistry.
In this patient, the aromatase expression in the tumor was presumably heterogeneous; thus, an extremely low expres- sion of aromatase in the portion subjected to the pathologi- cal analysis resulted in a discrepancy from the clinical fea- tures. As the promoter II and exon I.3 expression was de- tectable in the adrenal tumor by RT-PCR, measuring the lev- els of aromatase expression in the whole tumor by RT-PCR is useful for the diagnosis in order to correct the discrepancy between the pathological results and clinical features.
Immunohistochemistry showed a testosterone-producing
tumor, which differed from the clinical features. This was presumably caused by steroid disorganization at the site ana- lyzed pathologically. Due to heterogeneity of steroid synthe- sis in the adrenocortical carcinoma, the expression of ste- roidogenic enzymes may not be consistent with the clinical data, depending on the portions screened during the patho- logical analysis.
In this case, we observed the expression of promoter II and exon I.3 in the adrenal tumor, which presumably in- duced estrogen to cause feminization. As there are many discrepancies between the clinical symptoms and pathologi- cal features on a functional analysis of adrenocortical carci- noma, thorough endocrine testing is thus necessary before surgery.
The authors state that they have no Conflict of Interest (COI).
Acknowledgement
We thank Mr. Sasamoto and Mr. Honma (Asuka Medical Co.) for assistance with the measurement of intratumoral steroids.
References
1. Shimazaki A, Ichikawa T, Shiseki T, Kuramochi H. Statistical re- view of adrenal cortical carcinoma. Nihon Rinsho 51: 766-782, 1993 (in Japanese).
2. Wajchenberg BL, Albergaria Pereira MA, Medonca BB, et al. Adrenocortical carcinoma: clinical and laboratory observations. Cancer 88: 711-736, 2000.
3. Abiven G, Coste J, Groussin L, et al. Clinical and biological fea- tures in the prognosis of adrenocortical cancer: poor outcome of cortisol-secreting tumors in a series of 202 consecutive patients. J Clin Endocrinol Metab 91: 2650-2655, 2006.
4. Berruti A, Baudin E, Gelderblom H, et al. Adrenal cancer: ESMO clinical practice guidelines for diagnosis, treatment and follow up. Ann Oncol 23: vii131-vii138, 2012.
5. Fassnacht M, Libē R, Kroiss M, Allolio B. Adrenocortical carci- noma: a clinician’s update. Nat Rev Endocrinol 7: 323-335, 2011.
6. Allolio B, Fassnacht M. Clinical review: Adrenocortical carci- noma: clinical update. J Clin Endocrinol Metab 91: 2027-2037, 2006.
7. Pommier RF, Brennan MF. An eleven-year experience with adrenocortical carcinoma. Surgery 112: 963-971, 1992.
8. Ng L, Libertino JM. Adrenocortical carcinoma: diagnosis, evalu- ation and treatment. J Urol 169: 5-11, 2003.
9. Shouzu M, Usui H. Roles of aromatase on productive physiology. Sanfujinkachiryo 102: 466-474, 2011 (in Japanese).
10. Zayed A, Stock JL, Liepman MK, Wollin M, Longcope C. Feminization as a result of both peripheral conversion of andro- gens and direct estrogen production from an adrenocortical carci- noma. J Endocrinol Invest 17: 275-278, 1994.
11. Basaria S. Androgen abuse in athletes: detection and conse- quences. J Clin Endocrinol Metab 95: 1533-1543, 2010.
12. Wollina U, Pabst F, Schönlebe J, et al. Side-effects of topical an- drogenic and anabolic substances and steroids. Acta Dermatoven- erol Alp Pannonica Adriat 16: 117-122, 2007.
13. Fukai N, Hirono Y, Yoshimoto T, et al. A case of estrogen- secreting adrenocortical carcinoma with subclinical Cushing’s sy- drome. Endocr J 53: 237-245, 2006.
14. Young J, Bulun SE, Agarwal V, et al. Aromatase expression in a feminizing adrenocortical tumor. J Clin Endocrinol Metab 81: 3173-3176, 1996.
15. Phornphutkul C, Okubo T, Wu K, et al. Aromatase P450 expres- sion in a feminizing adrenal adenoma presenting as isosexual pre- cocious puberty. J Clin Endocrinol Metab 86: 649-652, 2001.
16. Advani A, Johnson SJ, Nicol MR, et al. Adult-onset hypogona- dotropic hypogonadism caused by aberrant expression of aromatase in an adrenocortical adenocarcinoma. Endocr J 57: 651- 656, 2010.
17. Horiba N, Nomura K, Demura H. Feminizing adrenocortical tu- mor. Ryoikibetsu Shokogun Shirizu 1: 472-474, 1993 (in Japa- nese).
18. Kimura M, Itoh N, Tsukamoto T, Kumamoto Y, Takagi Y, Mori Y. Aromatase activity in an estrogen-producing adrenocortical carci- noma in a young man. J Urology 153: 1039-1040, 1995.
19. Ojima M, Sasano N, Masuda T. Features of the steroidogenesis in functional adrenal carcinoma. Sogorinsho 30: 187-199, 1981 (in Japanese).
20. Sasano H. Localization of steroidogenic enzymes in adrenal cortex and its disorders. Endocr J 41: 471-482, 1994.
21. Suzuki T, Nakmura Y, Watanabe M, et al. Pathology of adrenal cortical carcinoma. Naibunpitsukoujyousenngekakaishi 30: 36-40, 2013 (in Japanese).
22. Sasano H, Suzuki T, Nagura H, Nishikawa T. Steroidogenesis in human adrenocortical carcinoma: biochemical activities, immuno- histochemistry, and in situ hybridization of steroidogenic enzymes and histopathologic study in nine cases. Human Pathol 24: 397- 404, 1993.
The Internal Medicine is an Open Access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/ by-nc-nd/4.0/).
C 2016 The Japanese Society of Internal Medicine http://www.naika.or.jp/imonline/index.html