Secretin Receptor Promotes the Proliferation of Endocrine Tumor Cells Via the PI3K/AKT Pathway

Misu Lee, Beatrice Waser, Jean-Claude Reubi, and Natalia S. Pellegata

Institute of Pathology (M.L., N.S.P.), Helmholtz Zentrum München, 85764 Neuherberg, Germany; and Institute of Pathology (B.W., J .- C.R.), University of Bern, 3012 Bern, Switzerland

The secretin receptor (SR), a G protein-coupled receptor, mediates the effects of the gastrointes- tinal hormone secretin on digestion and water homeostasis. Recently, high SR expression has been observed in pancreatic ductal adenocarcinomas, cholangiocellular carcinomas, gastrinomas, and bronchopulmonary carcinoid tumors. Receptor overexpression associates with enhanced secretin- mediated signaling, but whether this molecule plays an independent role in tumorigenesis is currently unknown. We recently discovered that pheochromocytomas developing in rats affected by the MENX (multiple endocrine neoplasia-like) syndrome express at very high-level Sctr, encod- ing SR. We here report that SR are also highly abundant on the membranes of rat adrenal and extraadrenal pheochromocytoma, starting from early stages of tumor development, and are functional. PC12 cells, the best characterized in vitro pheochromocytoma model, also express Sctr at high level. Thus, we used them as model to study the role of SR in neoplastic transformation. Small interfering RNA-mediated knockdown of Sctr decreases PC12 cells proliferation and increases p27 levels. The proproliferative effect of SR in PC12 cells is mediated, in part, by the phosphatidylinositol 3 kinase (PI3K)/serine-threonine protein kinase (AKT) pathway. Transfec- tion of Sctr in Y1 adrenocortical carcinoma cells, expressing low endogenous levels of Sctr, stimulates cell proliferation also, in part, via the PI3K/AKT signaling cascade. Because of the link between SR and PI3K/AKT signaling, tumor cells expressing high levels of the receptor (MENX-associated primary pheochromocytoma and NCI-H727 human bronchopulmonary car- cinoid cells) respond well and in a SR-dependent manner to PI3K inhibitors, such as NVP- BEZ235. The association between SR levels and response to PI3K inhibition might open new avenues for the treatment of tumors overexpressing this receptor. (Molecular Endocrinology 26: 1394-1405, 2012)

T he receptor of the secretin hormone is a glycopro- tein belonging to the B family of the G protein- coupled receptors. The receptors of vasoactive intesti- nal polypeptide (VIP) and glucagon are additional members of this family of proteins (1). The secretin receptor (SR) has long been known for mediating se- cretin’s important role in digestive functions and water homeostasis (2, 3). In physiological conditions, the hu- man SR gene, SCTR, is highly expressed in secretin target organs, such as pancreas, kidney, and small in- testine, and is expressed in the distal lung regions and liver, with trace levels in the brain, heart, and ovary (4).

Upon binding to the secretin ligand, the SR activates intracellular adenylate cyclase, which leads to an in- crease in cAMP (5, 6) and to the subsequent activation of protein kinase A (PKA) (7, 8). Recently, deregulated expression of the SCTR gene and/or of the SR protein have been identified in pathological conditions, namely, in tumors arising from physiological secretin target tis- sues. Specifically, high SR expression has been reported in pancreatic ductal adenocarcinomas (PDAC) (9) and in cholangiocellular carcinomas (10, 11) and gastrinomas (12). Bronchopulmonary carcinoid tumor cells were also found to present SR at high density on their membranes

(13). The functional consequences of SR overexpression in these tumors have yet to be fully explored.

MENX (multiple endocrine neoplasia-like) is a multi- tumor syndrome recently discovered in the rat, which is caused by a homozygous germline frameshift mutation in the Cdkn1b gene encoding the cell cycle inhibitor p27 (14). MENX-affected rats develop, among other endo- crine tumors, bilateral pheochromocytoma with com- plete penetrance within their first year of life (15). We recently performed transcriptome analysis of hyperplastic and neoplastic (pheochromocytoma) adrenomedullary lesions from MENX mutant rats and identified the Sctr gene as the ninth most highly expressed gene in hyperpla- sia compared with normal rat adrenal tissue (16). Up- regulation of Sctr transcript is a very early genetic change in this model, being already evident in the adrenal me- dulla of 1-month-old mutant rats, before they show his- topathological alterations in this tissue. Moreover, we found that rat PC12 cells, a well-established in vitro model of pheochromocytoma, also express the Sctr tran- script at very high levels (16). Altogether, these data sug- gest that overexpression of Sctr might be involved in rat pheochromocytoma pathophysiology.

Peptide hormone receptors are heavily studied as ther- apeutic targets, because they are often overexpressed in endocrine tumor cells and regulate the growth and secre- tory functions of these tumor cells upon binding with specific ligands. Somatostatin receptor targeting is the clinically best established example: due to the high level of expression of somatostatin receptors in gastroenteropan- creatic neuroendocrine tumors, these neoplasms can be visualized with radiolabeled somatostatin analogs, such as OctreoScan, and respond to targeted therapy with ra- diotoxic somatostatin analogs (17). As reported above, high expression of SR has been reported in several tumor entities, but the functional consequences of this genetic event are still unknown. Secretin, acting through its re- ceptor, is known to stimulate the growth of nonmalignant human and mouse large cholangiocytes (11), but a possi- ble direct role of SR in regulating cell proliferation has not been explored. Given both the potential of peptide hor- mone receptors as therapeutic targets and the high expres- sion of SR in a subset of human tumors, a better under- standing of the role that this molecule may play in tumorigenesis is highly relevant.

In the current study, we first demonstrate that the over- expression of the Sctr gene in MENX-associated adrenal and extraadrenal pheochromomocytoma translates into a high level of the functional receptor protein being present on the tumor cells, further supporting a potential role for this molecule in tumorigenesis. Then, we studied in more detail the effects of Sctr overexpression in adrenal-derived

tumor cell lines. We found that SR plays a proprolifera- tive role in adrenal tumor cells (PC12 and Y1), which is mediated, at least in part, by the phosphatidylinositol 3 kinase (PI3K)/serine-threonine protein kinase (AKT) pathway. Tumor cells expressing high levels of SR re- spond well to inhibitors of the PI3K signaling cascade, suggesting that SR levels may represent a potential pre- dictor of response to PI3K/AKT inhibition.

Materials and Methods

Rat tissue samples

Rat adrenal, pituitary, thyroid, and pancreas tissues were snap frozen in liquid nitrogen and stored at - 80 C. We analyzed by in vitro receptor autoradiography seven adrenal glands from mutant rats (ages 7-9 months) having pheochromocytoma and six adrenal glands of 2-month-old mutant rats having no detect- able pathological changes in the adrenal medulla. In parallel, we analyzed adrenal glands of wild-type age-matched rats (see Ta- ble 1). We also analyzed three rat paragangliomas and five rat thyroid tumors (C-cell carcinomas) and three rat pituitary ade- nomas obtained from MENX-affected rats. Pancreas from mu- tant and wild-type rats was used as positive control.

In vitro SR autoradiography

Rat tissues were investigated for SR protein expression on the basis of specific binding of radioiodinated secretin using in vitro autoradiography. The procedure was carried out as previ- ously described (13). Nonspecific radioligand binding was as- sessed by incubating tissue sections in the incubation solution containing 100 nM nonradiolabeled (cold) human secretin in addition to 125I-[Tyr10] rat secretin. At this concentration, cold secretin completely and specifically displaces 125I-[Tyr10] rat secretin at the receptors. To distinguish SR from other receptors of the same family, which bind secretin with low affinity, serial

TABLE 1. SR density in the adrenal glands of wild-type and mutant rats at different ages
No. ratp27 genotypeAge (months)SR density (mean ± SEM) (dpm/mg tissue)
09/1927wt/wt2Cortex, 0; medulla, 260 ± 260
06/883wt/wt3Cortex, 0; medulla, 446 + 45
06/884wt/wt3Cortex, 0; medulla, 649 + 72
09/1922wt/wt7Cortex, 0; medulla, 417 ± 206
08/822wt/wt7Cortex, 0
09/1636wt/wt7Cortex, 0
08/149wt/wt21Cortex, 0
09/1926mut/mut2Pheo, 2259 ± 539
10/147mut/mut2Pheo, 2511 ± 192
09/1925mut/mut2.5Pheo, 4898 ± 947
09/1635mut/mut7Cortex, 0; Pheo, 5178 ± 246
09/1923mut/mut7Pheo, 4086 ± 292
09/1924mut/mut7Pheo, 5557 + 776
09/833mut/mut8Cortex, 0; Pheo, 4942 + 136
09/858mut/mut9Cortex, 0; Pheo, 6211 ± 60

Density is reported for the adrenal cortex (cortex), the medulla, or the pheochromocytoma (Pheo) tissues of the rats ± SEM.

tissue sections were incubated with 125I-[Tyr10] rat secretin and increasing concentrations of one of the following cold peptides: human secretin, VIP (Bachem, Bubendorf, Switzerland), or glu- cagon (1-29) (Bachem). After incubation, the slides were washed five times in ice-cold HEPES containing 1% BSA and twice in ice-cold HEPES without BSA. The slides were dried for 15 min under a stream of cold air and then exposed to Kodak films Biomax MR for 7 d at 4 C (Kodak, Rochester, NY). The signals on the films were analyzed in correlation with morphology, using a corresponding hematoxylin and eosin-stained tissue sec- tion. The signal density was quantitatively assessed using tissue standards for iodinated compounds (Amersham, Aylesbury, UK) and using a computer-assisted image processing system (Analysis Imaging System, Interfocus, Mering, Germany). In all experiments, rat pancreas served as positive control.

Cell culture, transfections, and immunofluorescence

PC12 cells (purchased from LGC Promochem, Teddington, UK) were grown in F12 medium supplemented with 15% horse serum, 2.5% fetal calf serum; Y1 cells (kindly provided by Felix Beuschlein, Munich, Germany) were maintained in DMEM sup- plemented with 10% fetal bovine serum; and NCI-H727 cells (kind gift of Christoph J. Auernhammer, Munich, Germany) were grown as described (18). The human immortalized non- malignant cholangiocyte cell line H-69 was kindly provided by G. J. Gores (Mayo Clinic, Rochester, MN) and cultures were as described (19). Ex vivo pheochromocytoma cells from MENX mutant rats were established following the previous report (20).

Transient transfections in each cell lines were carried out as already reported (14). The plasmid expressing the Myc-Sctr fu- sion protein was generated by cloning the full-length rat Sctr cDNA into the pCMV-Myc vector backbone (CLONTECH, Heidelberg, Germany).

cAMP assays

PC12 cells were transfected with plasmid or small interfering RNA (siRNA) and were then incubated with 100 nM rat secretin (Phoenix Pharmaceuticals, Karlsruhe, Germany) in complete medium for additional 24 h. The concentration of cAMP was determined in each sample using a Parameter cAMP Assay kit (R&D Systems, Minneapolis, MN) according to the manufac- turer’s instructions.

RT-PCR analysis of SR and secretin transcripts

Receptor autoradiography results were confirmed by semi- quantitative and quantitative TaqMan RT-PCR for SR (Sctr/ SCTR) transcripts using RNA extracted from macrodissected adrenomedullary cells of the same tissue samples. Primers used for semiquantitative analysis were: rat Sctr forward (fw), atgct- cagcaccatgagac; rat Sctr reverse (rev), ttgctgcagcctcagatgatac. Moreover, we analyzed Sctr expression in mouse Y1 cells by semiquantitative RT-PCR using primers: mouse Sctr fw, ggtg- gagggcctctatcttc; mouse Sctr rev, ccaggcgcttataatggtgt. We an- alyzed SCTR expression in human H-69 and NCI-H727 cells by TaqMan RT-PCR. Quantitative RT-PCR was performed using TaqMan inventoried primers and probes for Sctr/SCTR and for the rat B-2-microglobulin gene, mouse ß-2-microglobulin gene or human TBP gene as internal control (Applied Biosystems, Foster City, CA). RNA was extracted, and TaqMan assays were set up as previously reported (16). For semiquantitative detec-

tion of secretin mRNA, we employed the following primers: rat Sct fw, cctacaggattggcttctgc and rat Sct rev, gcctggttgtttcagtc- cac; and mouse Sct fw, gcccttagaggaccagctct and mouse Sct rev, tgaacgatcaacagcagacc. Conditions for the RT-PCR reaction were as previously reported (16).

Protein extraction and Western blotting

For protein extraction, cells were collected after treatments, washed twice in PBS, and lysed in lysis buffer essentially as previously reported (21). Protein concentration was assessed by BCA assay (Pierce Chemical Co., Rockford, IL). Total extracts were subjected to polyacrylamide gel electrophoresis using Bis- Tris 4-12% NuPAGE gels, blotted, and probed with the fol- lowing antibodies: monoclonal, against phosphorylated-Akt (P-Akt) (Ser473), P-p42/44 MAPK (ERK1/2), and polyclonal against total-Akt, total-p44/42 MAPK (Erk1/2) (all from Cell Signaling, Beverly, MA); monoclonal anti-p27 (BD Biosciences, Franklin Lakes, NJ); and monoclonal anti-«-tubulin (Sigma, Steinheim, Germany). Immunoreactive proteins were visualized using West Pico chemiluminescent substrates (Pierce Chemical Co.). The bands that we obtained by Western blotting were quantified using the Molecular Imager ChemiDoct XRS and analyzed with Quantity Ones software (both from Bio-Rad Lab- oratories, Hercules, CA). Western blot analyses from biological replicates showed similar expression data, attesting to the re- producibility of the results.

Drug treatment and cell proliferation assays

NVP-BKM120 and NVP-BEZ235 were kindly provided from Novartis Pharma (Basel, Switzerland). NVP-BKM120 and NVP-BEZ235 were dissolved in dimethylsulfoxide (DMSO) and stored at -20 C. Dilutions to the final concentration were made in the culture medium right before use. PC12, Y1, and NCI-H727 cells (transfected or native), as well as primary rat pheochromocytoma cells, were seeded in 96-well plates treated with PI3K inhibitors, and cell proliferation was measured as previously reported (21). In some experiments, rat secretin (100 nM) or human secretin (Tocris, Bristol, UK) was added to the culture medium 1 h before adding NVP-BEZ235, and cells were then incubates for additional 24 h before assessing cell prolifer- ation. A reduction in proliferation of -20% was considered significant (21). The reported results represent the mean of six replicates ± SD.

Statistical analysis

Results of the cell viability assays are shown as the mean of values obtained in independent experiments ± SEM. A paired two-tailed Student’s t test was used to detect significance be- tween two series of data, and P < 0.05 was considered statisti- cally significant.

Results

SR expression in rat pheochromocytoma tissues

MENX mutant rats develop adrenomedullary hyper- plasia starting at 3-4 months of age; by the age of 6 months, they all present with bilateral pheochromocy- toma (14). We previously showed that the Sctr gene is

FIG. 1. Assessment of SR expression in serial rat adrenal gland tissue sections by receptor autoradiography. A, Hematoxyliln and eosin-stained tissue sections showing in the upper panels, A normal rat adrenal gland from a wild-type animal, the gland of a 2-month-old mutant rat, the gland of a 7-month-old mutant rat, and a paraganglioma from an 8-month- old mutant rat. The middle panels are autoradiograms showing total binding of 125I-[Tyr10] rat secretin to the tissues shown above. Very strong and homogeneous binding to the adrenomedullary tumor cells and paraganglioma cells in older mutant rats is observed, whereas glands of young mutant rats show heterogeneous binding. The lower panels represent autoradiograms showing nonspecific binding of 125I-[Tyr10] rat secretin in the presence of 100 nm cold human secretin. Complete displacement of 1251-[Tyr10] rat secretin by cold secretin provides proof of specific receptor binding in all four tissues. B and C, Representative pharmacological competition experiments showing displacement of 1251-[Tyr10] rat secretin by cold secretin, VIP, and glucagon (1-29) in (B) a pheochromocytoma and (C) pancreatic acini (control).

A

Adrenal gland

Paraganglioma

B

Pheochromocytoma

wild type

Mutant ( 2 mon)

Mutant ( 7 mon)

125-I rat-Secretin spec. binding %

100

50-

Secretin VIP

Glucagon

0

-11

-10

-9

-8

-7

-6

log[compound] (M)

C

Pancreatic Acini

125-I rat-Secretin spec. binding %

100

50

Secretin

VIP

Glucagon

0

-11

-10

log[compound] (M)

highly overexpressed in both adrenomedullary hyperpla- sia and pheochromocytoma vs. normal rat adrenal me- dulla (by microarray and TaqMan analysis), and this overexpression is already detectable in the adrenal me- dulla of 1-month-old mutant rats (16). Although both expression arrays and TaqMan give an estimate of the amount of transcript, a correlation with protein levels does not automatically follow. Therefore, we set out to determine whether overexpression of the Sctr transcript translates into higher amount of the encoded peptide in rat tumor cell membranes. To this aim, we performed SR autoradiography with radioactive 125I-[Tyr10] rat secretin ligand on adrenal glands of MENX-affected rats (n = 7, age 2-9 months) and of control wild-type rats (n = 6) (Table 1). We observed a much higher binding of the secretin radioligand in the adrenal medulla of mutant rats compared with wild-type rats (Fig. 1A), in agreement with the Sctr mRNA expression results. In affected ani- mals, radioligand binding increased with age, but it was already much higher in 2-month-old mutant rats than in age-matched wild-type littermates (Table 1). Because acini in the exocrine pancreas are known to express

high levels of SR (22), we employed this tissue as positive control for the autoradiography experiments. Very strong binding of the 125I-[Tyr10] se- cretin radioligand was observed in pancreata from both wild-type and mutant rats, with no differences in SR density and distribution between the two animal groups (Supplemental Fig. 1, published on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org).

RNA extracted from some of the ad- renomedullary tissue samples used for in vitro receptor binding experiments (two wild type and two mutant) was -9 -8 -7 -6 used for semiquantitative and quanti- tative real-time TaqMan analysis of the Sctr gene to confirm the relationship between mRNA and protein levels. Both methods showed a much higher level of Sctr mRNA in rat adrenomed- ullary lesions when compared with normal adrenal tissue (Supplemental Fig. 2, A and B). Ex vivo primary cul- tures of rat pheochromocytoma were also established, and we observed that these cells retain high Sctr expression (Supplemental Fig. 2B). While perform- ing Sctr transcript analysis, we also dis- covered that the pheochromocytoma cells in MENX rats only express the full-length Sctr transcript, and no variants produced by alternative splicing were detected (Supplemen- tal Fig. 2A). These variants have been identified in various human tumor entities and often associate with nonfunc- tional receptors (9, 23).

In addition to adrenal pheochromocytoma, MENX mu- tant rats develop extraadrenal pheochromocytoma (para- ganglioma) with a frequency of approximately 20%. At the mRNA level, rat paragangliomas show an expression of the Sctr gene even higher than the pheochromocytomas (several thousand-fold increase vs. normal adrenal medulla) (16). Three paragangliomas were analyzed using in vitro SR au- toradiography: they showed a homogeneous and very high expression level of SR protein (Fig. 1A).

MENX-affected rats develop hyperplastic and neo- plastic lesions also in thyroid and pituitary glands (14). Thus, we tested whether rat medullary thyroid tumor cell and pituitary adenoma cells express SR at high level too, but we could not observe differences in the amount of 125I-[Tyr10] secretin radioligand binding between wild-

FIG. 2. Down-regulation of Sctr inhibits proliferation and induces apoptosis of PC12 cells. A, PC12 cells were transfected with scrambled (negative control) or 125 ng/250 ng of anti-Sctr siRNA oligos. Cell proliferation was assessed 24 h later by measuring ATP levels. B, In parallel to A, Caspase 3/7 activity was measured to monitor apoptosis. C, In parallel to A, RNA from the transfected PC12 cells was extracted, and TaqMan RT-PCR was performed to monitor the expression level of p27. For A and B, data were analyzed independently with six replicates each and were expressed as the mean ± SEM; * , P < 0.05, vs. scrambled control.

A

Cell proliferation (% of control)

150

*

100

C

50

p27 mRNA expression (% of control)

200

0

scrambled

125ng Sctr siRNA

250ng Sctr siRNA

150

B

100

*

Caspase 3/7 activity (% of control)

150

50

I

0

100

scrambled

125ng Sctr siRNA

50

0

scrambled

125ng Sctr siRNA

250ng Sctr siRNA

type (normal) and mutant (tumor) rat tissues (Supplemen- tal Fig. 1).

Our in vitro receptor autoradiography studies show that, in MENX mutant rats, chromaffin cell-derived neu- roendocrine tumors, but not other tumor entities, present with high amount of functional SR molecules.

Pharmacological characterization of the SR in rat pheochromocytoma

Secretin binds with high affinity SR but also binds with lower affinity other receptors of the family, such as VIP and glucagon receptors (24). Therefore, it had to be proven that in the investigated adrenomedullary tissues, the radioligand 125I-[Tyr10] rat secretin was bound solely by SR. For this purpose, pharmacological competition experiments were performed to assess the rank order of potencies of secretin, VIP, and glucagon binding at the identified receptors. In all secretin-binding pheochromo- cytoma, 125I-[Tyr10] rat secretin was displaced by cold secretin with high affinity in the nanomolar concentration range and by VIP and glucagon with low affinity in the micromolar concentration range, as shown by two repre- sentative displacement curves for pheochromocytoma and pancreas control (Fig. 1B). This rank order of poten- cies provides strong pharmacological evidence that using receptor autoradiography, we specifically detected the SR in the mutant rat tumor tissues.

SR overexpression has a promitogenic role in adrenal chromaffin cells

Measurable levels of the SR pro- teins are detected in the adrenal me- dulla of 2-month-old MENX mutant rats (Table 1), before they show any gross histopathological changes in this organ, making this molecular change a very early one in pheochro- mocytoma development. We previ- 250ng Sctr siRNA ously showed that PC12 rat pheochro- mocytoma cells also express very high levels of the Sctr mRNA (average fold change, +200 vs. normal adrenal me- dulla) (16). To study whether the over- expression of SR may indeed play a role in tumorigenesis, we knocked down the expression of the endoge- nous Sctr gene in PC12 cells and checked for effects on cell prolifera- tion. Reduction of Sctr expression sig- nificantly inhibited cell proliferation (up to -40% at the 24-h posttransfec- tion time point) (Fig. 2A). To verify the efficiency of siRNA-mediated Sctr down-regulation, we could not rely on immunoblotting, because we had previously tested all commercially available antibodies against SR but failed to get a specific and reliable signal for the rat protein. Thus, we employed TaqMan RT-PCR, as shown in Supplemen- tal Fig. 3A, and observed a reduction of Sctr mRNA in siSctr-transfected PC12 cells (-85%). In addition, we set up a functional assay to measure intracellular cAMP lev- els. It has been shown that after treatment of PC12 cells with secretin, there is an activation of the cAMP pathway through stimulation of the SR (25). Therefore, we mea- sured intracellular cAMP levels as a readout of Sctr gene knockdown in PC12 cells. As expected, treatment with secretin increased the baseline cAMP level in untrans- fected PC12 cells (control) (Supplemental Fig. 3B). In the presence of Sctr overexpression (transfection of a plasmid expressing Myc-Sctr), addition of secretin caused an even greater increase in the intracellular amount of cAMP. In contrast, transfection with anti-Sctr siRNA oligos abro- gated secretin-mediated increase in cAMP (Supplemental Fig. 3B), providing indirect evidence of successful siRNA- mediated Sctr knockdown.

We then assessed whether reduced Sctr expression in- duced apoptosis by measuring the amount of cleaved Caspase 3/7. We observed a slight induction of apoptosis (+30%) after siRNA-mediated knockdown of Sctr in PC12 cells (Fig. 2B). Then, we checked whether reduced

FIG. 3. Role of SR in neurite outgrowth in PC12 cells and activation of downstream pathways. A, PC12 cells were plated on coverslips in 24-well plates, transfected with 250 ng of anti-Sctr siRNA oligos or Myc-Sctr plasmid or left untransfected. The next day, cells were incubated for additional 24 h with 100 nm secretin, fixed, and processed for immunofluorescent staining with antineurofilament high molecular weight protein (H) antibody. B and D, PC12 cells were transfected as in A and 24 h later incubated with 100 nM secretin. At the indicated time points, proteins were extracted, and Western blotting was performed to monitor P-p24/p44 MAPK (Thr202/Tyr204)/total-p42/p44 MAPK (B) and P-AKT (Ser473)/total-AKT (D) expression. C, PC12 cells were transfected as in A, and 24 h later, we assessed p27, P-AKT (Ser473), AKT, and «-tubulin expression levels by Western blotting. B-D, The ratios of the band intensities for phosphorylated proteins vs. total proteins, or for p27 vs. «-tubulin, normalized against the ratio in the untreated, scrambled-transfected control (ratio = 1), are reported below the panels.

A

Anti-neurofilament H

C

scrambled

si Sctr

+ Secretin

p27

pAKT (Ser473)

+ si Sctr

AKT

+ Secretin

a-tubulin

+ Myc-Sctr + Secretin

B

scrambled

si Sctr

D

scrambled

si Sctr

Secretin (min)

0

30

60

0

30

60

Secretin (min)

0

30

60

0

30

60

pp42/44 MAPK

pp42 pp44

PAKT (Ser473)

(Thr202/Tyr204)

p42/44 MAPK

p42

p44

AKT

proliferation of PC12 cells after Sctr knockdown was also associated to the induction of cell cycle inhibitors. To this aim, we determined whether the level of expression of the G1 phase cyclin-dependent kinase inhibitors Cdkn2c (p18), Cdkn1a (p21), and Cdkn1b (p27) changed after knockdown of Sctr. Among these genes, Cdkn1b (p27) showed the most pronounced increase in expression in siSctr-transfected PC12 cells (+32%) (Fig. 2C and data not shown). To confirm this finding, we performed West- ern blot analysis and observed an increase in the amount of the p27 protein in PC12 cells with knockdown of Sctr (see Fig. 3C). In conclusion, a reduction in the expression of Sctr decreases the proliferation of pheochromocytoma cells and leads to an increase in Cdkn1b/p27 levels.

The level of SR modulates the neurotrophic effects of secretin in PC12 cells

Secretin treatment induces neurite formation in PC12 cells (26). This phenomenon is mediated by the stimula- tion of SR, followed by the activation of the MAPK p42/ p44 (also known as Erk2 and Erk1) (27). We decided to determine whether the amount of SR affects neuritogen-

esis in PC12 cells treated with secretin. To this aim, PC12 cells were trans- fected with anti-Sctr siRNA, exposed to secretin, and subsequently analyzed for neurite formation, by staining for neurofilament H (28), and for the ex- pression of activated (phosphorylated) p42/44 MAPK. Knockdown of Sctr ex- pression abrogates both secretin-medi- ated neurite outgrow (Fig. 3A) and ac- tivation of P-p42/44 MAPK in PC12 cells (Fig. 3B). These data demonstrate that reducing the amount of SR impairs the neurotrophic effect of secretin on PC12 cells.

SR inhibits cell viability of rodent adrenal cells through the PI3K/ AKT pathway

As illustrated above, after siRNA- mediated knockdown of Sctr expression in PC12 cells, we observed an increase in Cdkn1b transcript and p27 protein (Fig. 3C). p27 lies downstream of several sig- naling cascades involved in cell prolifer- ation, apoptosis, and migration, includ- ing the PI3K/AKT/mammalian target of rapamycin (mTOR) pathway. Indeed, activation of AKT is associated to a de- crease in p27 levels in a variety of normal and tumor cell types (29). To determine whether alterations in AKT signaling caused the increase of p27 in PC12 cells, we transfected them with anti-Sctr siRNA oligos and then assessed the amount of P-AKT. We observed that the level of P-AKT (Ser473), but not that of total-AKT, decreases in cells with reduced Sctr expression, concomi- tantly with an increase in p27 amount (Fig. 3C). This effect is also observed when siSctr-transfected PC12 cells are ex- posed to the secretin ligand to activate receptor signaling (Fig. 3D). Therefore, down-regulation of Sctr in PC12 cells decreases AKT activity in basal and secretin-stimulated con- ditions, and this in turn increases the amount of p27.

Altogether, the results that we reported so far sup- port a proproliferative role of SR in PC12 adrenomed- ullary tumor cells mediated, in part, by activation of the PI3K/AKT pathway. To determine whether this re- ceptor plays a similar role also in other endocrine cells, we employed the Y1 cell line derived from an adreno- cortical carcinoma. These cells have low levels of en- dogenous Sctr, as demonstrated by RT-PCR (Fig. 4A), and have not been reported to respond to secretin treat- ment. Thus, we ectopically introduced the SR in Y1

FIG. 4. Overexpression of Sctr promotes cell growth and activates downstream pathways in Y1 cells. A, Semiquantitative RT-PCR was performed using primer specific to the mouse Sctr. The level of mRNA was normalized against Gadph. B, Y1 cells were incubated with 1 µg of mock vector or Myc-Sctr plasmid. Cell proliferation was assessed 24 h later by measuring ATP levels. C, In parallel to B, we monitored the P-AKT, total-AKT, P-p42/p44 MAPK(Thr202/Tyr204) and total-p42/p44 MAPK, and «-tubulin expression levels by Western blotting. D, Y1 cells were transfected as in B and 24 h later incubated with 100 nM secretin. At indicated time points, proteins were extracted, and Western blotting was performed to monitor P-p24/p44 MAPK (Thr202/Tyr204)/total-p42/p44 MAPK and P-AKT (Ser473)/total-AKT expression. C and D, The ratios of the band intensities for P-AKT vs. total-AKT, normalized against the ratio in the mock-transfected control (ratio = 1), are reported below the panels. ** , P < 0.01.

A

Mouse pancreas

water

C

Mock Myc-Sctr

Y1

pAKT (Ser473)

Sctr

AKT

pp42/44 MAPK

Gapdh

(Thr202/Tyr204)

pp42

pp44

p42/44 MAPK

p42

1

p44

B

D

MOCK

Myc-Sctr

160

Secretin (min)

**

0

30

60

0

30

60

Cell proliferation (% of control)

120

PAKT (Ser473)

AKT

80

pp42/44 MAPK

(Thr202/Tyr204)

40

p42/44 MAPK

0

Mock

Myc-Sctr

cells by transfecting a plasmid expressing this molecule as Myc-tagged fusion protein. Control cells were trans- fected with the mock vector. Immunofluorescent stain- ing using an anti-Myc antibody confirmed the expres- sion of the exogenous SR (Supplemental Fig. 4). Overexpression of SR increased the proliferation of Y1 cells compared with mock-transfected cells (+30%) (Fig. 4B). Concordantly, high SR amount augmented the levels of P-p42/44 MAPK and P-AKT (Fig. 4C). The increase in the phosphorylated form of these kinases is less pronounced in Y1 cells than in PC12 cells, proba- bly because the basal level of expression of P-AKT and P-MAPK is higher in the former than in the latter cell line (data not shown). We observed an increase in pro- liferation also of Sctr-transfected Y1 cells stimulated with secretin (Fig. 4D). In conclusion, the modulation of the levels of Sctr (up- or down-regulation) in two rodent cell lines derived from adrenal gland tumors supports a proproliferative role for this molecule in basal and secretin-stimulated conditions. To assess whether the effect of SR on cell proliferation in the absence of externally provided secretin could be due to an autocrine mechanism of stimulation, we assessed the expression of the secretin transcript in PC12 and Y1 cells and also in ex vivo primary rat pheochromocy- toma cells. As shown in Supplemental Fig. 5, no endog-

enous secretin mRNA was detected in Y1 and rat primary pheochromocy- toma cells, whereas PC12 cells show expression of Sctr, albeit at reduced level compared with duodonenum control tissue.

SR expression sensitizes endocrine tumor cells to inhibitors of the PI3K/AKT pathway

To obtain additional evidence sup- +pp42 4-pp44 porting a role for the PI3K/AKT path- +p42 +p44 way in mediating SR-dependent effects on cell proliferation, we employed two inhibitors of this signaling cascade and checked their effect on cell growth in the presence of varying amounts of the receptor. Specifically, we used NVP- BKM120, a PI3K inhibitor, and NVP- BEZ235, a dual PI3K/mTOR inhibi- tor. Y1 cells transfected with Myc-Sctr vector (high SR level) or with the mock vector (low SR level) were treated with different concentrations of NVP- BKM120 or of NVP-BEZ235, and cell proliferation was assessed. After drug treatment, Y1 cells overexpressing the SR showed a stronger reduction in cell proliferation when compared with mock-transfected cells (Fig. 5, A and C). Specifically, we observed a reduction in cell viability of -60% in Myc-Sctr-transfected cells treated with 1 µM NVP-BKM120, and of -42% in transfected cells treated with 0.5 MM NVP-BEZ235, whereas untransfected cells had a much lower reduction at the same drug concentra- tions, especially upon NVP-BKM120 treatment. In agree- ment with the cell proliferation results, immunoblotting revealed a lower amount of activated P-AKT and P-MAPK in drug-treated, SR-transfected Y1 cells com- pared with drug-treated, mock-transfected cells (Fig. 5, B and D). Altogether, these data suggest that the response of Y1 cells to inhibitors of the PI3K pathway is, at least in part, dependent on the amount of SR.

Based on these results, we formulated the hypothesis that tumor cells expressing high SR levels should re- spond well to PI3K inhibitors. As mentioned earlier, ex vivo rat primary pheochromocytoma cultures express high levels of Sctr (Supplemental Fig. 2B). Thus, we checked the response of these cells to NVP-BEZ235. We incubated eight independent ex vivo rat primary pheochromocytoma cultures with this drug and then assessed cell survival. NVP-BEZ235 treatment signifi- cantly reduced cell viability (-22%) already at the con-

FIG. 5. Effect of high SR expression on the response of Y1 cells to PI3K inhibitors. Y1 cells were transfected with mock vector or Myc-Sctr plasmid and 24 h later treated with the NVP- BKM120 (A), NVP-BEZ235 (C), or DMSO. Cell proliferation was assessed 24 h later by measuring ATP levels. * , P < 0.05; ** , P < 0.01 (Myc vs. SR). B and D, In parallel samples with A and C, we assessed the p-AKT (Ser473) and total-AKT expression levels by Western blotting. The ratios of the band intensities for P-AKT vs. total-AKT, normalized against the ratio in the untreated control (CT) (ratio = 1), are reported below the panels.

A

MOCK

☐ Myc-Sctr

C

MOCK

120

**

120

Cell proliferation (% of control)

Cell proliferation (% of control)

I

80

80

40

40

0

0

NVP-BKM120

CT

0.1

1

CT

0.1

1

NVP-BEZ235

CT

0.3

0.5

B

MOCK

Myc-Sctr

D

MOCK

NVP-BKM120

CT

0.1

1

CT

0.1

1

NVP-BEZ235

CT

0.3

0.5

pAKT

pAKT

(Ser473)

(Ser473)

AKT

AKT

centration of 10 nm (Supplemental Fig. 6A). Also, PC12 cells express SR at high levels. When incubated with NVP-BEZ235, PC12 cells showed a significant decrease in cell proliferation (-50%) when compared with untreated cells (Supplemental Fig. 6B). Addition of secretin to the culture media 1 h before drug treat- ment lead to an even greater inhibition of cell prolifer- ation, suggesting that SR activation further sensitizes PC12 cells to the effects of the drug.

SR autoradiography has shown that pulmonary carci- noid tumor cells have a very high SR density on their membranes (13). Thus, we hypothesized that cells derived from this tumor entity might respond well, and possibly in a SR-dependent manner, to the growth inhibitory effects of PI3K inhibitors. We employed the NCI-H727 cell line derived from a human pulmonary carcinoid tumor as ex- perimental model to test our hypothesis. We first deter- mined the expression level of SCTR in NCI-H727 cells by TaqMan RT-PCR and compared it with that of the hu- man immortalized cholangiocyte cells line H-69, previ- ously reported to have high endogenous levels of the SCTR transcript (11). The results show that NCI-H727 cells express higher levels of SCTR (+40-fold) when com- pared with H-69 cells (Fig. 6A). Similarly to what we observed in PC12 cells, treatment of NCI-H727 cells with NVP-BEZ235 significantly reduced their proliferation (-30%) when compared with untreated cells, and the presence of secretin to stimulate receptor signaling SR lead to a further decrease in proliferation (Supplemental Fig. 6C).

NCI-H727 cells were then transfected with anti-SCTR siRNA oligos, or with scrambled oligos, and then treated

with NVP-BEZ235 (concentrations 0.1 ☐ * CT 0.3 0.5 Myc-Sctr CT 0.3 0.5 Myc-Sctr and 1 µM). Cell proliferation was as- sessed 24 h later. At the dose of 0.1 µLM, we observed a significant reduction (-22%) in the proliferation of NCI- H727 cells transfected with scrambled siRNA oligos (Fig. 6B). Concomitantly, we observed a strong reduction of P-AKT already at the 0.1 µM concentra- tion in scrambled siRNA-transfected cells. In contrast, after siRNA-mediated SCTR gene knockdown, the response of NCI-H727 cells to NVP-BEZ235 is re- duced when compared with cells trans- fected with scrambled-siRNA both at the cellular (cell proliferation) and molecu- lar (amount of P-AKT) level (Fig. 6, B and C). Indeed, siSCTR-transfected car- cinoid cells showed less prominent de- crease in cell proliferation compared with scrambled-transfected cells and displayed appreciable reduction of P-AKT only after exposure to the highest drug concentration (1 µM), whereas no change was observed at the 0.1 µM concentration (Fig. 6C). Thus, high SR levels sensitize human bronchopulmonary carcinoid cells to PI3K inhibition.

SR gene and protein in human pheochromocytoma

After our discovery that MENX-associated adrenomed- ullary lesions express Sctr at high levels and possess high amount of functional SR molecules on their membranes, we checked whether human pheochromocytomas are also char- acterized by an up-regulation of the SCTR gene. We per- formed real-time quantitative RT-PCR for SCTR on a panel of 30 sporadic and 13 familial human pheochromocytoma samples that we previously described (16). These samples include adrenal and extraadrenal pheochromocytomas (16). The results show that SCTR is overexpressed in only two out of 43 adrenal tumors (Table 2). The two tumors having higher SCTR expression do not possess distinctive clinical parameters. Both were noradrenergic (in total seven out of 43 were noradrenergic). The infrequent involvement of SCTR in human pheochromocytoma was also confirmed by in vitro receptor binding using radioactive 125I-[Tyr10] se- cretin as ligand: none of the 13 human pheochromocytoma samples that we analyzed showed detectable expression of the receptor (Supplemental Fig. 7).

Discussion

Our study shows that SR are overexpressed in various endocrine tumor cells and play a proproliferative role in

FIG. 6. Effect of SCTR down-regulation of on the response of NCI-H727 cells to PI3K inhibitors. A, Quantitative RT-PCR (TaqMan assay) for SCTR on H69 and NCI-H727 cells was performed. B, NCI-H727 cells were transfected with 250 ng of scrambled or anti-SCTR siRNA oligos and 24 h later treated with NVP-BEZ235 or DMSO. Cell proliferation was assessed 24 h later by measuring ATP levels. C, In parallel, we monitored the p-AKT (Ser473) and total-AKT expression levels by Western blotting. The ratios of the band intensities for P-AKT vs. total- AKT, normalized against the ratio in the untreated control (CT) (ratio = 1), are reported below the panels. * , P < 0.05.

A

SCTR mRNA expression

60

(vs. H69)

40

20

C

0

H69

NCI-H727

scrambled

siSCTR

B

scrambled

☐ siSCTR

NVP-BEZ235

CT

0.1

1

CT

0.1

1

pAKT

120

(Ser473)

*

Cell proliferation (% of control)

100

AKT

80

60

40

20

0

NVP-BEZ235

CT

0.1

1

CT

0.1

1

pheochromocytoma and adrenocortical carcinoma cells. Moreover, we also demonstrate that SR signal, in part, through the PI3K/AKT pathway and their high expres- sion, can sensitize cells to inhibitors of this signaling cascade.

After our previous observation of a very high expres- sion of the Sctr gene in MENX-associated pheochromo- cytoma and paraganglioma (16), we here demonstrate that SR is highly expressed in these tumors also at the protein level. Importantly, in vitro receptor autoradiog- raphy shows that the SR is not only present on chromaffin tumor cells of MENX-affected rats, but it is indeed func- tional, being able to bind its natural ligand. We observed that the adrenomedullary cells of 2-month-old MENX mutant rats already possess a much higher density of SR on their membranes when compared with age-matched wild-type rats, in agreement with previous mRNA-based data on Sctr expression. SR density increases with time in affected rats, mirroring tumor progression. These obser- vations support the hypothesis of a possible involvement of SR overexpression in rat pheochromocytoma tumori- genesis. We further addressed this issue by using PC12 pheochromocytoma cells as experimental model. Indeed, we previously reported that PC12 cells, similarly to MENX-associated pheochromocytoma (16), express Sctr at high level. To determine whether SR indeed plays a role in pheochromocytoma development, we evaluated the ef- fect of modulating Sctr expression levels on PC12 cell

proliferation. We observed that siRNA- mediated knockdown of Sctr decreased PC12 cell proliferation (-40%), sup- porting a proproliferative role for SR in this model. Importantly, this proprolif- erative effect occurred in basal condi- tions, in the absence of addition of the secretin ligand to the culture medium. Because PC12 cells are the only available pheochromocytoma cell line, we ex- tended our analysis to another adrenal tumor-derived cell line, Y1 cells, derived from a murine adrenocortical carci- noma. We observed that also in these cells high expression of Sctr promotes proliferation.

Our results are in agreement with recent data showing that SR is impor- tant for regulating the basal prolifera- tion of large cholangiocytes in mice. In the study by Onori et al. (11), Sctr ex- pression was stably silenced by RNA interference in immortalized large mouse cholangiocyte cells. After Sctr knockdown, the authors observed a reduction in the pro- liferative capacity of the siRNA-transfected cells com- pared with mock-transfected cells. The authors inter- preted their findings as being the results of a possible secretin-mediated autocrine regulation of basal prolifer- ation of large murine cholangiocytes. We have not de- tected secretin mRNA expression in Y1 cells nor in MENX-associated pheochromocytoma cells, so an auto- crine stimulatory loop is not likely to occur in these cells. In contrast, PC12 cells do express secretin transcript at low level, so the possibility of an autocrine receptor stim- ulation cannot be completely ruled out. However, the effect of SR on tumor cell proliferation is not dependent on secretin stimulation, because it is takes place in Y1 cells that do not produce the hormone.

While analyzing the Sctr transcript in MENX-associ- ated pheochromocytoma tissues and primary tumor cells, we observed that they express only the full-length tran- script of the gene. In human tissues (normal and neoplas-

TABLE 2. Clinical characteristics of the two human pheochromocytoma patients having high levels of SCTR
Sample IDSexAgeTumor size (cm)Tumor biologySCTRSecreted hormone
PGL 295M743Benign6.97Noradrenalin
FI 326F375Benign12.01Noradrenalin

SCTR values represent relative expression values normalized against normal adrenal medulla. M, Male; F, female.

tic), splice variants of the SCTR gene have been identified and, in some cases, functionally characterized. For exam- ple, the splice variant with deletion of exon 3, observed in gastrinomas and PDAC, is nonfunctional and may also silence the wild-type receptor (9, 23). The finding that MENX rat pheochromocytoma cells do not express splice variants of Sctr is in agreement with the in vitro autora- diography data showing high levels of the functional SR on the membrane of these cells.

Data obtained several years ago concerning the re- sponse of PC12 cells to several peptide hormones can now be reinterpreted in light of the very high expression of Sctr that we found in these cells. In 1989, Roskoski et al. (30) reported that PC12 cells respond to neuropeptides mem- bers of the secretin family (namely, secretin, VIP, peptide histidine isoleucine, and glucagon) by increasing the ac- tivity of the enzyme tyrosine hydroxylase. Secretin showed a greater potency in activating tyrosine hydrox- ylase and in increasing cAMP levels when compared with the other tested peptides. The authors postulated the ex- istence of secretin-preferring receptors in PC12 cells. These results could also be the consequence of the very high amount of Sctr expression in PC12 cells.

PC12 cells are particularly sensitive to treatment with growth factors, especially nerve growth factor, which can promote their differentiation into neuron-like cells able to form neurites (31). Secretin is among the factors able to induce neurite outgrowth in PC12 cells, thanks to the pres- ence of SR (26). Down-regulation of Sctr attenuates secretin- dependent neurite formation, indicating that the receptor is essential to relay the differentiation signals triggered by the hormone. Although this might be intuitive, to our knowl- edge, it had not been demonstrated before.

At the molecular level, incubation of PC12 cells with secretin has been found to stimulate the classical signal transduction pathway: CAMPPKAERK1/2 (ERK1/2 are also named p42/p44 MAPK). Secretin-dependent stimulation of this signaling cascade in PC12 cells has been shown to mediate the transcriptional activation of the endogenous tyrosine hydroxylase (Th) gene (32), the transcription of the chromogranin A (Cga) gene, the ma- jor vesicular core protein (33), and neurite formation (26). Consistent with these findings, we found that silenc- ing of the Sctr gene in PC12 cells causes inhibition of p42/p44 MAPK (ERK1/2) phosphorylation. The obser- vation that p27 levels increase in PC12 cells after knock- down of Sctr prompted us to extend our analysis to the PI3K/AKT pathway in these cells. Indeed, p27 is a direct target of the AKT kinase and, in many cell types, activa- tion of the PI3K pathway results in down-regulation of p27 and increased proliferation (29, 34). We observed that knockdown of Sctr inhibits the phosphorylation of

AKT in pheochromocytoma cells, suggesting that the re- ceptor can also signal through this signaling cascade.

Encouraged by these initial findings, we decided to verify whether SR signal through the PI3K/AKT also in the adrenal-derived Y1 cell line. In contrast to the PC12 cells, Y1 cells express low endogenous levels of Sctr and no detectable secretin transcript. Thus, we transfected and ectopically overexpressed SR into these cells. High amount of the receptor enhances the phosphorylation of both AKT and p42/p44 MAPK and consequently stimu- lates Y1 cell proliferation, as mentioned above. These results further support the existence of a relationship be- tween SR and PI3K/AKT signaling. This discovery is not entirely surprising, because other peptide receptors of the SR family signal through cAMP/PKA/ERK1-2 but also through PI3K/AKT, including VIP (35), glucagon-like peptide 1 (36, 37), and pituitary adenylate cyclase-acti- vating polypeptide (38). However, the SR had not been previously associated to PI3K/AKT signaling.

The PI3K/AKT/mTOR pathway sustains proliferation and survival and is hyperactivated in a great variety of human tumor cells. For this reason, drugs that inhibit this signaling cascade at various levels have been generated, and some of them are being evaluated in clinical trials for the therapy of various solid tumors (39, 40). To better estimate the contribution of PI3K/AKT signaling in me- diating the proproliferative effect of the SR, we modu- lated the amount of the receptor in Y1 cells in the presence or absence of NVP-BKM120, a PI3K inhibitor, or NVP- BEZ235, a dual PI3K/mTOR inhibitor. Y1 cells overex- pressing ectopic SR and incubated with these drugs showed a more pronounced reduction in cell proliferation and a stronger inhibition of AKT phosphorylation when compared with untransfected cells. These results pro- vided indirect evidence that SR may stimulate cell prolif- eration in part by activating PI3K/AKT signaling. In agreement with these data, we could also show that ex- posure of PC12 cells or of ex vivo cultures of primary pheochromocytoma cells from MENX mutant rats to NVP-BEZ235 significantly reduced their viability, dem- onstrating that cells possessing high levels of SR respond well to the antiproliferative effects of PI3K inhibitors. It should be noted that although MENX-affected rats have low levels of p27 protein in their cells, upstream signaling through the PI3K/AKT pathway is not affected (21). In- cubation of PC12 cells with secretin enhanced the anti- proliferative effect of NVP-BEZ235, thereby suggesting that high SR levels or its stimulation by the ligand sensi- tizes these cells to PI3K inhibition. In line with our results showing that tumor cells expressing Sctr at high levels respond well to compounds blocking the PI3K/AKT sig- naling cascade are studies showing a substantial decrease

in PC12 cell proliferation upon treatment with LY294002, a PI3K inhibitor (41). Our observation that the SR can stimulate the proliferation of specific tumor cells and does so, at least in part, by activating the PI3K/ AKT pathway opens novel possibilities for the treatment of tumors expressing this receptor at high level.

In human tumors, SR does not seem to be involved in pheochromocytoma development, because these tumors (both sporadic and familial) rarely show overexpression of the SCTR gene (2/43, 4.6%) or of the receptor protein, as demonstrated by in vitro autoradiography. Con- versely, SR may play a role in human bronchopulmonary carcinoid tumors. Indeed, it has been shown that the ma- jority of these carcinoid tumor cells possess high SR den- sity on their membrane by in vitro autoradiography (13). Patients suffering from bronchopulmonary carcinoid tu- mors may present with multiple lesions and also with distant metastases leading to an unfavorable outcome. These tumors poorly respond to conventional chemother- apy, therefore surgical resection is the only therapeutic option. However, surgery can be problematic in cases with multiple carcinoids or metastatic spread. As such, there is a need for new treatment modalities. Based on our results showing that high SR levels sensitize to the anti- proliferative effects of PI3K inhibitors, we predicted that lung carcinoid tumor cells would respond well to such compounds and employed the human bronchopulmo- nary carcinoid tumor cell line NCI-H727 to verify our hypothesis. Indeed, these cells express high levels of en- dogenous SCTR. Exposure of NCI-H727 cells to NVP- BEZ235 strongly inhibits their proliferation. After knockdown of SCTR gene expression, these cells become less sensitive to the antitumor potential of the drug, whereas upon stimulation of the receptor by secretin, their sensitivity to NVP-BEZ235 increases. Molecular analysis of downstream effector proteins confirm our hy- pothesis that SR stimulates cell proliferation in part by activating PI3K/AKT signaling also in human tumor cells.

Our data raise the intriguing possibility that the level of SR may represent a predictor of response to compounds targeting the PI3K pathway. Further studies, analyzing additional tumor entities expressing the receptor at high level are required to validate our hypothesis. In any case, the association between SR expression and response to PI3K inhibition provides the rationale for a novel thera- peutic approach for tumors expressing the receptor, in- cluding, in addition to lung carcinoids, also PDAC and cholangiocarcinomas. Noteworthy, a recent preclinical study reported that NVP-BEZ235 displays antitumor ac- tivity against experimental PDAC in vitro and in vivo (42). Concerning cholangiocarcinomas, in vitro data have demonstrated that combination treatment of the chemo-

therapeutic agent oxalipatin with LY294002 (PI3K inhib- itor) arrests cell proliferation (43), but the effect of PI3K/ AKT inhibition alone has not yet been assessed in these tumor cells. It will be interesting to evaluate whether the good response to NVP-BEZ235 in these tumor entities is also in part dependent on the expression of the SR.

Given the newly discovered proproliferative role of SR in pheochromocytoma, the MENX syndrome, having high amount of functional receptor molecules on the membranes of adrenal and extraadrenal chromaffin tu- mor cells, represents a useful model for further investigat- ing the functions of the receptor in tumorigenesis and for testing agents targeting this receptor in vivo.

Acknowledgments

We thank Elenore Samson and David Mörzl for excellent tech- nical assistance and Novartis Oncology for providing us with the drugs.

Address all correspondence and requests for reprints to: Na- talia S. Pellegata, Institute of Pathology, Helmholtz Zentrum München, Ingolstaedter Landstrasse 1, 85764 Neuherberg, Germany. E-mail: natalia.pellegata@helmholtz-muenchen.de.

This work was supported by the Deutsche Forschungsge- meinschaft Grant SFB824-A04 and the Deutsche Krebshilfe Grant 107973 (to N.S.P.).

Disclosure Summary: The authors have nothing to disclose.

References

1. Segre GV, Goldring SR 1993 Receptors for secretin, calcitonin, parathyroid hormone (PTH)/PTH-related peptide, vasoactive intes- tinal peptide, glucagonlike peptide 1, growth hormone-releasing hormone, and glucagon belong to a newly discovered G-protein- linked receptor family. Trends Endocrinol Metab 4:309-314

2. Chey WY, Chang TM 2003 Secretin, 100 years later. J Gastroen- terol 38:1025-1035

3. Chu JY, Lee LT, Lai CH, Vaudry H, Chan YS, Yung WH, Chow BK 2009 Secretin as a neurohypophysial factor regulating body water homeostasis. Proc Natl Acad Sci USA 106:15961-15966

4. Davis RJ, Page KJ, Dos Santos Cruz GJ, Harmer DW, Munday PW, Williams SJ, Picot J, Evans TJ, Sheldrick RL, Coleman RA, Clark KL 2004 Expression and functions of the duodenal peptide secretin and its receptor in human lung. Am J Respir Cell Mol Biol 31:302-308

5. Kato A, Gores GJ, LaRusso NF 1992 Secretin stimulates exocytosis in isolated bile duct epithelial cells by a cyclic AMP-mediated mech- anism. J Biol Chem 267:15523-15529

6. Lenzen R, Alpini G, Tavoloni N 1992 Secretin stimulates bile ductular secretory activity through the cAMP system. Am J Physiol 263:G527-G532

7. Alpini G, Glaser SS, Ueno Y, Pham L, Podila PV, Caligiuri A, LeSage G, LaRusso NF 1998 Heterogeneity of the proliferative capacity of rat cholangiocytes after bile duct ligation. Am J Physiol 274:G767-G775

8. Das R, Esposito V, Abu-Abed M, Anand GS, Taylor SS, Melacini G 2007 cAMP activation of PKA defines an ancient signaling mecha- nism. Proc Natl Acad Sci USA 104:93-98

9. Körner M, Hayes GM, Rehmann R, Zimmermann A, Friess H, Miller LJ, Reubi JC 2005 Secretin receptors in normal and diseased human pancreas: marked reduction of receptor binding in ductal neoplasia. Am J Pathol 167:959-968

10. Körner M, Hayes GM, Rehmann R, Zimmermann A, Scholz A, Wiedenmann B, Miller LJ, Reubi JC 2006 Secretin receptors in the human liver: expression in biliary tract and cholangiocarcinoma, but not in hepa- tocytes or hepatocellular carcinoma. J Hepatol 45:825-835

11. Onori P, Wise C, Gaudio E, Franchitto A, Francis H, Carpino G, Lee V, Lam I, Miller T, Dostal DE, Glaser SS 2010 Secretin inhibits cholangiocarcinoma growth via dysregulation of the cAMP-depen- dent signaling mechanisms of secretin receptor. Int J Cancer 127: 43-54

12. Ding WQ, Kuntz S, Böhmig M, Wiedenmann B, Miller LJ 2002 Dominant negative action of an abnormal secretin receptor arising from mRNA missplicing in a gastrinoma. Gastroenterology 122: 500-511

13. Körner MU, Hayes GM, Carrigan PE, Rehmann R, Miller LJ, Reubi JC 2008 Wild-type and splice-variant secretin receptors in lung cancer: overexpression in carcinoid tumors and peritumoral lung tissue. Mod Pathol 21:387-395

14. Pellegata NS, Quintanilla-Martinez L, Siggelkow H, Samson E, Bink K, Höfler H, Fend F, Graw J, Atkinson MJ 2006 Germ-line mutations in p27Kip1 cause a multiple endocrine neoplasia syndrome in rats and humans. Proc Natl Acad Sci USA 103:15558-15563

15. Molatore S, Pellegata NS 2010 The MENX syndrome and p27: relationships with multiple endocrine neoplasia. Prog Brain Res 182:295-320

16. Molatore S, Liyanarachchi S, Irmler M, Perren A, Mannelli M, Ercolino T, Beuschlein F, Jarzab B, Wloch J, Ziaja J, Zoubaa S, Neff F, Beckers J, Höfler H, Atkinson MJ, Pellegata NS 2010 Pheo- chromocytoma in rats with multiple endocrine neoplasia (MENX) shares gene expression patterns with human pheochromocytoma. Proc Natl Acad Sci USA 107:18493-18498

17. Virgolini I, Traub T, Novotny C, Leimer M, Fuger B, Li SR, Patri P, Pangerl T, Angelberger P, Raderer M, Burggasser G, Andreae F, Kurtaran A, Dudczak R 2002 Experience with indium-111 and yttrium-90-labeled somatostatin analogs. Curr Pharm Design 8:1781-1807

18. Zitzmann K, de Toni E, von Rüden J, Brand S, Göke B, Laubender RP, Auernhammer CJ 2011 The novel Raf inhibitor Raf265 de- creases Bcl-2 levels and confers TRAIL-sensitivity to neuroendo- crine tumour cells. Endocr-Relat Cancer 18:277-285

19. Grubman SA, Perrone RD, Lee DW, Murray SL, Rogers LC, Wolkoff LI, Mulberg AE, Cherington V, Jefferson DM 1994 Reg- ulation of intracellular pH by immortalized human intrahepatic biliary epithelial cell lines. Am J Physiol 266:G1060-G1070

20. Lichtenauer UD, Shapiro I, Geiger K, Quinkler M, Fassnacht M, Nitschke R, Rückauer KD, Beuschlein F 2008 Side population does not define stem cell-like cancer cells in the adrenocortical carcinoma cell line NCI h295R. Endocrinology 149:1314-1322

21. Lee M, Theodoropoulou M, Graw J, Roncaroli F, Zatelli MC, Pellegata NS 2011 Levels of p27 Sensitize to Dual PI3K/mTOR Inhibition. Mol Cancer Ther 10:1450-1459

22. Ulrich 2nd CD, Wood P, Hadac EM, Kopras E, Whitcomb DC, Miller LJ 1998 Cellular distribution of secretin receptor expression in rat pancreas. Am J Physiol 275:G1437-G1444

23. Long SH, Berna MJ, Thill M, Pace A, Pradhan TK, Hoffmann KM, Serrano J, Jensen RT 2007 Secretin-receptor and secretin-receptor- variant expression in gastrinomas: correlation with clinical and tumoral features and secretin and calcium provocative test results. J Clin Endocrinol Metab 92:4394-4402

24. Ulrich 2nd CD, Holtmann M, Miller LJ 1998 Secretin and vasoac- tive intestinal peptide receptors: members of a unique family of G protein-coupled receptors. Gastroenterology 114:382-397

25. Ip NY, Baldwin C, Zigmond RE 1985 Regulation of the concen-

tration of adenosine 3’,5’-cyclic monophosphate and the activity of tyrosine hydroxylase in the rat superior cervical ganglion by three neuropeptides of the secretin family. J Neurosci 5:1947-1954

26. Kim HS, Yumkham S, Kim SH, Yea K, Shin YC, Ryu SH, Suh PG 2006 Secretin induces neurite outgrowth of PC12 through cAMP- mitogen-activated protein kinase pathway. Exp Mol Med 38:85-93

27. Fukuda M, Gotoh Y, Tachibana T, Dell K, Hattori S, Yoneda Y, Nishida E 1995 Induction of neurite outgrowth by MAP kinase in PC12 cells. Oncogene 11:239-244

28. Takeda S, Okabe S, Funakoshi T, Hirokawa N 1994 Differential dynamics of neurofilament-H protein and neurofilament-L protein in neurons. J Cell Biol 127:173-185

29. Liang J, Zubovitz J, Petrocelli T, Kotchetkov R, Connor MK, Han K, Lee JH, Ciarallo S, Catzavelos C, Beniston R, Franssen E, Slingerland JM 2002 PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated G1 arrest. Nat Med 8:1153-1160

30. Roskoski Jr R, White L, Knowlton R, Roskoski LM 1989 Regula- tion of tyrosine hydroxylase activity in rat PC12 cells by neuropep- tides of the secretin family. Mol Pharmacol 36:925-931

31. Greene LA, Tischler AS 1976 Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci USA 73:2424-2428

32. Mahata M, Zhang K, Gayen JR, Nandi S, Brar BK, Ghosh S, Ma- hapatra NR, Taupenot L, O’Connor DT, Mahata SK 2011 Cate- cholamine biosynthesis and secretion: physiological and pharma- cological effects of secretin. Cell Tissue Res 345:87-102

33. Mahapatra NR, Mahata M, O’Connor DT, Mahata SK 2003 Se- cretin activation of chromogranin A gene transcription. Identifica- tion of the signaling pathways in cis and in trans. J Biol Chem 278:19986-19994

34. Shin I, Yakes FM, Rojo F, Shin NY, Bakin AV, Baselga J, Arteaga CL 2002 PKB/Akt mediates cell-cycle progression by phosphoryla- tion of p27(Kip1) at threonine 157 and modulation of its cellular localization. Nat Med 8:1145-1152

35. Anderson P, Gonzalez-Rey E 2010 Vasoactive intestinal peptide induces cell cycle arrest and regulatory functions in human T cells at multiple levels. Mol Cell Biol 30:2537-2551

36. Buteau J, Roduit R, Susini S, Prentki M 1999 Glucagon-like pep- tide-1 promotes DNA synthesis, activates phosphatidylinositol 3-kinase and increases transcription factor pancreatic and duodenal homeobox gene 1 (PDX-1) DNA binding activity in ß (INS-1)-cells. Diabetologia 42:856-864

37. Hui H, Nourparvar A, Zhao X, Perfetti R 2003 Glucagon-like peptide-1 inhibits apoptosis of insulin-secreting cells via a cyclic 5’-adenosine monophosphate-dependent protein kinase A- and a phosphatidylinositol 3-kinase-dependent pathway. Endocrinology 144:1444-1455

38. May V, Lutz E, Mackenzie C, Schutz KC, Dozark K, Braas KM 2010 Pituitary adenylate cyclase-activating polypeptide (PACAP)/ PAC1HOP1 receptor activation coordinates multiple neurotrophic signaling pathways: Akt activation through phosphatidylinositol 3-kinase y and vesicle endocytosis for neuronal survival. J Biol Chem 285:9749-9761

39. Engelman JA 2009 Targeting PI3K signalling in cancer: opportuni- ties, challenges and limitations. Nat Rev Cancer 9:550-562

40. Guertin DA, Sabatini DM 2007 Defining the role of mTOR in cancer. Cancer Cell 12:9-22

41. Adler JT, Hottinger DG, Kunnimalaiyaan M, Chen H 2009 Inhibition of the PI3K pathway suppresses hormonal secretion and limits growth in pheochromocytoma cells. World J Surg 33:2452-2457

42. Awasthi N, Yen PL, Schwarz MA, Schwarz RE 2012 The efficacy of a novel, dual PI3K/mTOR inhibitor NVP-BEZ235 to enhance che- motherapy and antiangiogenic response in pancreatic cancer. J Cell Biochem 113:784-791

43. Leelawat K, Narong S, Udomchaiprasertkul W, Leelawat S, Tung- pradubkul S 2009 Inhibition of PI3K increases oxaliplatin sensitiv- ity in cholangiocarcinoma cells. Cancer Cell Int 9:3