p53 MUTATIONS IN SPORADIC ADRENOCORTICAL TUMORS

H. OHGAKI, P. KLEIHUES! and P.U. HEITZ

Department of Pathology, University Hospital, Zurich, Switzerland.

Non-familial human adrenocortical adenomas and carcino- mas were screened for mutations in exons 5-8 of the p53 tumor suppressor gene by single-strand-conformation-polymorphism (SSCP) analysis, followed by direct sequencing of PCR-amplified DNA. Point mutations in codons 12, 13 and 61 in H-ras, K-ras and N-ras proto-oncogenes were similarly assessed by direct DNA sequencing. Three out of 15 primary adrenocortical carcinomas (20%) contained a mis-sense point mutation in the conserved regions (exons 5 and 8) of the p53 gene. Mutations were located in codon 157 (GTC TTC; Val Phe), codon 163 (TAC AAC; Tyr Asn), and codon 273 (CGT TGT; Arg Cys). The mutation in codon 157 was detected in the primary tumor as well as in brain and lymph-node metastases. Among 18 adrenocortical adenomas, there was only a single non-miscoding mutation in codon 295 (CCT CCC; Pro Pro). These data suggest that mutational inactivation of the p53 gene occurs in a minority (20%) of sporadic adrenocortical carcino- mas and that these mutations constitute a late event in the multi-step process of malignant transformation. No ras muta- tions were detected in any of these tumors, suggesting that these genes are not involved in the development of tumors originating from the adrenal cortex. @ 1993 Wiley-Liss, Inc.

Adrenocortical carcinomas constitute highly malignant tu- mors with a mortality rate of more than 50% (Weiss et al., 1989). They occur in all age groups, but are most common in the 5th to 7th decade (Barzilay and Pazianos, 1989). A minority of neoplasms affects children who may be genetically predisposed (Mcwhirter et al., 1989; Tsunematsu et al., 1991). Patients with the dominantly inherited Li-Fraumeni syndrome also develop adrenocortical carcinomas, although at an inci- dence of only 1% (Malkin et al., 1990; Srivastava et al., 1990). These patients carry germ-line mutations of the p53 tumor- suppressor gene, which are clustered in exon 7 (codons 245 to 258). Recently, Sameshima et al. (1992b) reported p53 germ- line mutations in exon 8 (codons 286 and 307) in 2 Li-Fraumeni- syndrome families identified by selection for the presence of childhood adrenocortical carcinomas.

The genetic alterations involved in the development of non-familial adrenocortical neoplasms are still poorly under- stood. Yano et al. (1989) reported a loss of heterozygosity of chromosomes 17p, 11p and 13q in 6 of 6 (100%), 4 of 6 (67%) and 3 of 6 (50%) adrenocortical carcinomas respectively. Since the p53 tumor-suppressor gene is located on chromosome 17p, we screened non-familial adrenocortical adenomas and carci- nomas for p53 point mutations. Since p53 and ras genes may cooperate in malignant transformation (Finlay et al., 1989), we also assessed the presence of point mutations in the ras genc family.

MATERIAL AND METHODS

Tumor samples

Eighteen adrenocortical adenomas, 15 adrenocortical carci- nomas and 3 metastases from adrenocortical carcinomas were collected during the years 1971 to 1991. The mean age of patients with adrenocortical adenomas was 45 years (range, 18 to 62 years; 5 males and 13 females). Patients with adrenocor- tical carcinomas had a mean age of 50 years (range; 20-84 years; 5 males, 10 females). The histopathological distinction between adenomas and carcinomas was based on the criteria defined by Weiss (1984).

Tissues were fixed by immersion in 4% formaldehyde and embedded in paraffin. DNA was extracted from paraffin

sections as described by Shibata et al. (1988), with slight modifications. Briefly, after comparison with serial sections stained with hematoxylin and eosin, tumors were scraped off the histological slide. Samples were de-paraffinized with xy- lene and washed with absolute ethanol. Dried samples were treated with 500 µg/ml of proteinase K (Boehringer, Mannheim, Germany) in 50 to 100 ul of digestion buffer (50 mM Tris, pH 8.5, 1 mM EDTA, and 0.5% Tween 20) at 55°℃ for 3 hr. After inactivation of proteinase K by heating at 95℃ for 10 min, samples were kept at -20℃ until PCR reaction.

PCR-SSCP analysis

For pre-screening of the samples for mutations in the p53 gene, PCR-single-strand-conformation-polymorphism (SSCP) analysis was performed according to a slight modification of the method of Orita et al. (1989). Briefly, PCR was performed with 2 ul of DNA solution, 2.5 pmol of each primer, 50 p.M of dNTPs, 1 µCi of [@-32P]-dCTP (Amersham, Aylesbury, UK, specific activity 3000 Ci/mmol), 10 mM Tris (pH 8.8), 50 mM KCI, and 1 mM MgCl2, 0.5 U Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT) in a final volume of 10 pl. After adding 10 ul of mineral oil (Sigma, St. Louis, MO), 40 cycles of denaturation (95℃) for 50 sec, annealing (63℃ for exons 5, 6, 7; 58℃ for exon 8) for 50 sec and extension (72℃) for 70 sec were done in an automated DNA Thermal Cycler (Perkin-Elmer Cetus). Primer sequences were as follows: 5’-TTCCTCTTCCTGCAGTACTC and 5’-ACCCTGGG- CAACCAGCCCTGT for exon 5, 5’-ACAGGGCTGGTTGC- CCAGGGT and 5’-AGTTGCAAACCAGACCTCAG for exon 6, 5’-GTGTTGTCTCCTAGGTTGGC and 5’-GTCAGAG- GCAAGCAGAGGCT for exon 7, and 5’-TATCCTGTAG- TAGTGTAATC and 5’-AAGTGAATCTGAGGCATAAC for exon 8. After PCR, the reaction mixture (1.5 ul) was mixed with 2 ul 0.2 M NaOH and 9 ul of sequencing stop solution (USB, Cleveland, OH). Samples were heated at 95℃ for 10 min and immediately loaded onto a 6% polyacrylamide non- denaturating gel containing 7.5% glycerol. Gels were run at 7 W for 13 to 15 hr at room temperature and dried at 80°C. Autoradiography was performed with an intensifying screen for 5 to 48 hr and the patterns of single-strand DNA were checked for differences from those of normal DNA.

Direct DNA sequencing of PCR products

For the samples which scored positive with SSCP analysis, PCR was performed with 10 ul of DNA solution, 10 pmol of cach primer, 200 pM dNTPs, 10 mM Tris (pH 8.8), 50 mM KCI, 1 mM MgCl2, and 2.5 U Taq polymerase in a total volume of 60 ul. After amplification, 50 ul of the PCR reaction was electrophoresed on a 6% polyacrylamide gel. The amplified bands were cut out, eluted in 0.5 M ammonium acetate and 1 mM EDTA at 37℃ overnight and precipitated with ethanol. Dried DNA was re-suspended in 15 ul of TE buffer.

Sanger dideoxynucleotide sequencing was performed using [@-32P]-dATP and primers for amplification. The template-

1To whom correspondence and reprint request should be sent, at Institute of Neuropathology, Department of Pathology, University Hospital, CH-8091 Zurich, Switzerland. Fax: 01-255-4402.

Received: December 24, 1992 and in revised form February 13, 1993.

primer mixture in 10 ul reaction buffer (10% dimethylsulfox- ide, 20 mM Tris-HCI, pH 7.5, 10 mM MgCl2, and 25 mM NaCl) was heated at 95℃ for 5 min and immediately placed in liquid nitrogen. After adding 0.1 M dithiothreitol, 0.5 pCi [@-32P]- dATP and 2U Sequenase version 2.0 DNA polymerase (USB), samples were divided into 4 wells each containing termination mixtures and incubated at 37℃ for 10 min. Samples were mixed with 4 ul stop solution, heated at 80℃ for 2 min and immediately loaded onto a 6% polyacrylamide/7 M urea gel. Gels were dried and autoradiographed for 1 to 5 days.

Exons 1 and 2 of H-, K- and N-ras genes were amplified and directly sequenced as described above. Primers for amplifica- tions were 5’-CTGAGGAGCGATGACGGAAT and 5’-AGTGGGGTCGTATTCGTCCA for exon 1 of H-ras, 5’- CTACCGGAAGCAGGTGGTCA and 5’-CGCATGTACT- GGTCCCGCAT for exon 2 of H-ras, 5’-GACTGAATATAAA- CTTGTGG and 5’-CTATTGTTGGATCATATTCG for exon 1 of K-ras, 5’-TTCCTACAGGAAGCAAGTAG and 5’- CACAAAGAAAGCCCTCCCCA for exon 2 of K-ras, 5’-TGACTGAGTACAAACTGGT and 5’-GGGCCT- CACCTCTATGGTGG for exon 1 of N-ras and 5’-TCTTA- CAGAAAACAAGTGGT and 5’-ATACACAGAGGAA- GCCTTCG for exon 2 of N-ras genes. The primers for sequencing were 5’-TCCACAAAATGGTTCT for exon 1 of H-ras, 5’-AGACGTGCCTGTTGGACATC for exon 2 of H-ras, 5’-TCTGAATTAGCTGTATCGTC for exon 1 of K-ras, 5’- GTAATTGATGGAGAAACCTG for exon 2 of K-ras, 5’- GATTAGCTGTATTGTCAGTG for exon 1 of N-ras, and 5’-GGTGAAACCTGTTTGTTGGA for exon 2 of N-ras genes.

RESULTS

SSCP analysis showed 6 samples with altered migration, indicating the presence of a mutation. Sequencing analysis confirmed miscoding p53 point mutations in 3 of 15 (20%) primary adrenocortical carcinomas (Table I). One CGT TGT transition mutation was found in the carcinoma of a 26-year-old female patient and affected codon 273 (Arg Cys). Another mutation was identified in the adrenocortical carci- noma of a 59-year-old male patient. This TAC AAC trans- version occurred at codon 163 and led to amino-acid substitu- tion Tyr Asn. In addition, a GTC TTC transversion (Val Phe) in codon 157 was present in a primary adrenocor- tical carcinoma in a 37-year-old female patient. The same mutations were also found in 2 metastatic lesions (brain and lymph nodes) from this adrenocortical carcinoma (Table I) but not in the normal part of adrenal cortex from the same patient. The typical DNA sequencing autoradiographs are shown in Figure 1. One adenoma contained a non-miscoding mutation at codon 295 (CCT CCC; Pro Pro). All other adenomas scored negative. No mutation was found in exons 1 and 2 of H-ras, K-ras and N-ras genes in any of the adrenocortical adenomas and carcinomas.

DISCUSSION

There is increasing evidence that the multistage develop- ment of malignant tumors is associated with the cumulative acquisition of genetic alterations which comprise both the activation of proto-oncogenes and the inactivation of tumor suppressor genes (Weinberg, 1989). In human neoplasms, the most frequently involved proto-oncogenes are of the ras gene family, while the p53 gene is the most frequent tumor- suppressor gene (Nigro et al., 1989; Hollstein et al., 1991; Levine et al., 1991). The p53 gene encodes a nuclear phospho- protein and is considered to play an essential role in the regulation of cell proliferation (Boyd and Barrett, 1990). While the wild-type p53 acts as a tumor-suppressor gene, p53 mutations occurring within highly conserved domains not only

TABLE I - p53 MUTATIONS IN NON-FAMILIAL HUMAN ADRENOCORTICAL TUMORS
AgeGenderDiagnosisExonCodonMutationAmino-acid substitution
35FAdenoma8295CCT - CCCPro -> Pro
26FCarcinoma8273CGT -> TGTArg -> Cys
37FCarcinoma5157GTC -> TTCVal -> Phe
Brain metas- tasis5157GTC -> TTCVal -> Phe
Lymph-node metastasis5157GTC-> TTCVal -> Phe
59FCarcinoma5163TAC -> AACTyr -> Asn
FIGURE 1 - DNA sequencing autoradiographs of p53 mutations in adrenocortical carcinomas. (a) TAC -> AAC (Tyr -> Asn) in codon 163 in adrenocortical carcinoma. (b) CGT -> TGT (Arg -> Cys) in codon 273 in adrenocortical carcinoma. (c) GTČ -> TTC (Val -> Phe) in codon 157 in the brain metastasis of an adrenocortical carcinoma.

ACGT

ACGT

ACGT

En

TVA

G/T

codon 163

codon 273

codon 157

cause loss of tumor-suppressor function but may even activate p53 to an oncogene in a dominant negative fashion (Finlay et al., 1989; Eiyahu et al., 1989). Various human tumors have been shown to contain either loss of both alleles of the p53 gene, the loss of one p53 allele with an associated point mutation, insertion or deletion of the remaining allele, or inactivation of the p53 gene in one allele but a normal (wild-type) sequence in the other.

The present study shows that 3 of 15 (20%) primary adrenocortical carcinomas contained miscoding point muta- tions in the conserved region of the p53 tumor-suppressor gene, suggesting that loss of its function may play an important role in the development of some non-familial adrenocortical carcinomas. The low frequency of p53 mutations observed in this study and the high frequency (100%) of 17p loss described by Yano et al. (1989) suggest the existence of an additional tumor-suppressor gene on the short arm of chromosome 17. This has also been suggested on the basis of molecular genetic analyses of human brain and breast neoplasms. Frankel et al. (1992) reported that 36% of gliomas with loss of heterozygosity in 17p did not contain p53 mutations. Similarly, 8 out of 8 medulloblastomas (Saylors et al., 1991) and 7 out of 7 pediatric primitive neuro-ectodermal tumors (Biegel et al., 1992) with allelic loss of 17p lacked p53 mutations. The results of the deletion mapping on chromosome 17p by Sato et al. (1990) implied the loss of an as-yet unidentified tumor-suppressor gene distal to the p53 locus in primary human breast cancer.

The emergence of adrenocortical carcinomas from adreno- cortical hyperplasia has occasionally been observed (Hamwi et al., 1957; Bauman and Bauman, 1982), but a clear-cut adenoma-

to-carcinoma sequence has not been established. On the basis of histopathological criteria alone, the distinction between adenomas and carcinomas may be difficult, particularly in well-differentiated tumors (Weiss et al., 1989; Weiss, 1984; Von Slooten et al., 1985). Occasionally, proof of the malignant nature relies on the presence of metastases. In the present study, only one adenoma (6%) contained a p53 mutation and this was not miscoding (Pro Pro). The increased frequency in carcinomas suggests that, in this tumor type, p53 mutations constitute a late event in the evolution of malignant transforma- tion. The observation of identical p53 mutations in one primary adrenocortical carcinoma and its lymph-node and brain metastases indicates that metastatic spread to other tissues is not associated with selection against p53 inactivation.

A similar correlation was reported for primary and metastatic lung tumors (Sameshima et al., 1992a).

In contrast to many tumors at other organ sites where ras mutations are frequent, notably pancreas, lung and colon (Bos, 1989), the present study clearly shows that activation of ras genes by point mutations is not involved in the evolution of adrenocortical tumors.

ACKNOWLEDGEMENTS

We thank Dr. E.W. Newcomb, Department of Pathology, New York University, for critical review of the manuscript. The excellent technical assistance of Ms. S. Graf and Ms. P. Saremaslani is gratefully acknowledged. This work was sup- ported by the Cancer League of the Canton of Zurich and by the Swiss National Science Foundation.

REFERENCES

BARZILAY, J.I. and PAZIANOS, A.G., Adrenocortical carcinoma. Urolo- genic Clinics N. America, 16, 457-468 (1989).

BAUMAN, A. and BAUMAN, C.G., Virilizing adrenocortical carcinoma: development in a patient with salt-losing congenital adrenal hyperpla- sia. J. Amer. med. Ass., 248, 3140-3141 (1982).

BIEGEL, J.A., BURK, C.D., BARR, F.G. and EMANUEL, B.S., Evidence of 17p tumor-related locus distinct from p53 in pediatric primitive neuro-ectodermal tumors. Cancer Res., 52, 3391-3395 (1992).

Bos, J.L., ras oncogenes in human cancer: a review. Cancer Res., 49, 4682-4689 (1989).

BOYD, J.A. and BARRETT, J.C., Tumor-suppressor genes: possible functions in the negative regulation of cell proliferation. Molec. Carcinogen., 3, 325-329 (1990).

EIYAHU, D., MICHALOVITZ, D., EIYAHU, S., PINHASH-KIMHI, O. and OREN, M., Plasmids encoding wild-type p53 can inhibit oncogenic- mediated transformation. Proc. nat. Acad. Sci. (Wash.), 86, 8763-8767 (1989).

FINLAY, C., HINDS, P. and LEVINE, A.J., The p53 proto-oncogene can act as a suppressor of transformation. Cell, 57, 1083-1093 (1989).

FRANKEL, R.H., BAYONA, W., KOSLOW, M. and NEWCOMB, E.W., p53 mutations in human malignant gliomas: comparison of loss of heterozy- gosity with mutation frequency. Cancer Res., 52, 1427-1433 (1992).

HAMWI, G.J., SERBIN, R.A. and KRUGER, F.A., Does adrenocortical hyperplasia result in adrenocortical carcinoma? New Engl. J. Med., 257, 1153-1157 (1957).

HOLLSTEIN, M.C., SIDRANSKY, D., VOGELSTEIN, B. and HARRIS, C.C., p53 mutations in human cancers. Science, 253, 49-53 (1991).

LEVINE, A.J., MOMAND, J. and FINLAY, C.A., The p53 tumor- suppressor gene. Nature (Lond.), 351, 453-456 (1991).

MALKIN, D., LI, F.P., STRONG, L.C., FRAUMENI, J.F., NELSON, C., KIM, D.H., KASSEL, J., GRYKA, M.A., BISHOFF, F.Z., TAINSKY, M.A. and FRIEND, S.H., Germ-line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science, 250, 1222-1238 (1990).

MCWHIRTER, W.R., STILLER, C.A. and LENNOX, E.L., Carcinomas in childhood. A registry-based study of incidence and survival. Cancer, 63, 2242-2246 (1989).

NIGRO, J.M., BAKER, S.J., PREISINGER, A.C., JESSUP, J.M., HOSTETTER, R., CLEARY, K., BIGNER, S.H., DAVIDSON, N., BAYLIN, S., DEVILEE, P., GLOVER, T., COLLINS, F.S., WESTON, A., MONDALI, R., HARRIS, C.C. and VOGELSTEIN, B., Mutations in the p53 gene occur in diverse human tumor types. Nature (Lond.), 342, 705-708 (1989).

ORITA, M., SUZUKI, Y., SEKIYA, T. and HAYASHI, K., A rapid and sensitive detection of point mutations and genetic polymorphisms using polymerase chain reaction. Genomics, 5, 874-879 (1989).

SAMESHIMA, Y., MATSUNO, Y., HIROHASHI, S., SHIMOSATO, Y., MIZU- GUCHI, H., SUGIMURA, T., TERADA, M. and YOKOTA, J., Alterations of the p53 gene are common and critical events for the maintenance of malignant phenotypes in small-cell lung carcinoma. Oncogene, 7, 451-457 (1992a).

SAMESHIMA, Y., TSUNEMATSU, Y., WATANABE, S., TSUKAMOTO, T., KAWA-HA, K., HIRATA, Y., MIZOGUCHI, H., SUGIMURA, T., TERADA, M. and YOKOTA, J., Detection of novel germ-line p53 mutations in diverse cancer-prone families identified by selecting patients with childhood adrenocortical carcinoma. J. nat. Cancer Inst., 84, 703-707 (1992b).

SATO, T., TANIGAMI, A., YAMAKAWA, K., AKIYAMA, F., KASUMI, F., SAKAMOTO, G. and NAKAMURA, Y., Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer. Cancer Res., 50, 7184-7189 (1990).

SAYLORS, R.L. III, SIDRANSKY, D., FRIEDMAN, H.S., BIGNER, S.H., BIGNER, D.D., VOGELSTEIN, B. and BRODEUR, G.M., Infrequent p53 gene mutations in medulloblastomas. Cancer Res., 51, 4271-4723 (1991).

SHIBATA, D.K., ARNHEIM, N. and MARTIN, W.J., Detection of human papilloma virus in paraffin-embedded tissue using the polymerase chain reaction. J. exp. Med., 167, 225-230 (1988).

SRIVASTAVA, S., Zou, Z., PIROLLO, K., BLATTNER, W. and CHANG, E.H., Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature (Lond.), 348, 747-749 (1990).

TSUNEMATSU, Y., WATANABE, S., OKA, T., TSUKAMOTO, T., KAWA-HA, K., HIRATA, Y., YAMANAKA, H., OHIRA, M. and ONO, M., Familial aggregation of cancer from proband cases with childhood adrenal cortical carcinoma. Jap. J. Cancer Res., 82, 893-900 (1991).

VON SLOOTEN, H., SCHABERG, A., SMEENK, D. and MOOLENAAR, A.J., Morphologic characteristics of benign and malignant adrenocortical tumors. Cancer, 55, 766-773 (1985).

WEINBERG, R.A., Oncogenes, anti-oncogenes, and the molecular bases of multistep carcinogenesis. Cancer Res., 49, 3713-3721 (1989).

WEISS, L.M., Comparative histologic study of 43 metastasizing and non-metastasizing adrenocortical tumors. Amer. J. surg. Pathol., 8, 163-169 (1984).

WEISS, L.M., MEDEIROS, L.J. and VICKERY, A.L., Pathologic features of prognostic significance in adrenocortical carcinoma. Amer. J. surg. Pathol., 13, 202-206 (1989).

YANO, T., LINEHAN, M., ANGLARD, P., LERMAN, M.I., DANIEL, L.N., STEIN, C.Y.A., ROBERSON, C.N., LAROCCA, R. and ZBAR, B., Genetic changes in human adrenocortical carcinomas. J. nat. Cancer Inst., 81, 518-523 (1989).