Check for updates
FLCN-Driven Functional Adrenal Cortical Carcinoma with High Mitotic Tumor Grade: Extending the Endocrine Manifestations of Birt-Hogg-Dubé Syndrome
Renee Hofstedter1D . Maria Carolina Sanabria-Salas2(D . Maria Di Jiang2 . Shereen Ezzat3(D . Ozgur Mete 4,5D . Raymond H. Kim 1,2,6[D
Accepted: 9 January 2023 / Published online: 26 January 2023 @ The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature 2023
Abstract
Adrenal cortical carcinoma is an aggressive and rare malignancy of steroidogenic cells of the adrenal gland. Most adult adrenal cortical carcinomas are sporadic, but a small fraction may be associated with inherited tumor syndromes, such as Li-Fraumeni, multiple endocrine neoplasia 1, Lynch syndrome, and Beckwith-Wiedemann syndrome, as well as isolated case reports of non-syndromic manifestations occurring in the context of other pathogenic germline variants. Birt-Hogg-Dubé (BHD) is a rare autosomal dominant syndrome caused by germline pathogenic variants in the FLCN gene. BHD syndrome causes a constellation of symptoms, including cutaneous manifestations, pulmonary cysts and pneumothorax, and risk of renal tumors. With the exception of a single case of adrenal cortical carcinoma, very few reports on the occurrence of adrenal cortical neoplasia in patients with BHD syndrome have been described. However, information on variant allele fraction in the tumor was not available in the index case, which precludes any mechanism supporting loss of heterozygosity. Here we present a case of an adult-onset adrenal cortical carcinoma in a 50-year-old female, found to harbor a germline likely patho- genic variant in the FLCN gene, denoted as c.694C> T (p.Gln232Ter). Genetic testing on the tumor revealed the same FLCN variant at an allele fraction of 83%, suggesting a contributory role to the pathogenesis of the adrenal cortical carcinoma. This case further supports the expansion of the clinical presentation and tumor spectrum of BHD syndrome and the need to consider germline FLCN testing in the clinical genetic workup of patients with adrenal cortical carcinomas.
Keywords Adrenal cortical carcinoma . FLCN . Birt-Hogg-Dubé syndrome . Germline variants · Functional adrenal cortical carcinoma
Introduction
Adrenal cortical carcinoma (ACC) is an aggressive endocrine cancer originating from steroidogenic cells of the adrenal gland. ACC is a rare malignancy with an annual incidence of
1.02 per million populations in the USA [1]. It is reported that most cases are diagnosed in advanced stages when survival is poor [1]. Most ACCs are sporadic, but a proportion can be associated with a hereditary cancer syndrome (HCS) including Li-Fraumeni - LFS (MIM 151623); Beckwith-Wiedemann
☒ Ozgur Mete ozgur.mete2@uhn.ca
☒ Raymond H. Kim
1 Bhalwani Familial Cancer Clinic, Princess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada
2 Department of Medicine, Division of Medical Oncology and Hematology, Princess Margaret Cancer Centre, University Health Network, University of Toronto, Toronto, ON M5G 2C1, Canada
3 Endocrine Oncology Site Group, Princess Margaret Cancer Centre, University of Toronto, Toronto, ON, Canada
4 Department of Pathology, University Health Network, Toronto General Hospital, 11th floor, Toronto, ON M5G 2C4, Canada
5 Department of Laboratory Medicine and Pathobiology, Temerty Faculty of Medicine, University of Toronto, Toronto, ON, Canada
6 Division of Clinical and Metabolic Genetics, The Hospital for Sick Children, Ontario Institute for Cancer Research, Toronto, ON, Canada
- BWS (MIM 130650); multiple endocrine neoplasia 1 - MEN1 (MIM 131100); familial adenomatous polyposis - FAP (MIM 75100); Lynch syndrome - LS (MIM 120435); SDH deficiency syndrome (MIM 614165, 115310, 605373, 168000, 601650); neurofibromatosis type 1 (MIM 162200); and Carney complex-CNC (MIM 160980) [2-8], as well as rare case reports in the context of non-syndromic pathogenic germline variants (e.g., ATM, MUTYH, CHEK2, BRCA2) [9-12]. More evidence of the genetic heterogeneity charac- terizing ACC has been emerging with the adoption of wide- spread germline gene panel testing in patients with endocrine cancers, as more associated germline variants are detected [3]. In addition, recurrent tumor mutations in TP53, ZNFR3, CTNNB1, PRKAR1A, CCNE1, TERF2, CDKN2A, RB1, and MEN1 are well-known driver genes discovered through char- acterization of somatic molecular alterations identified in sporadic tumors [13, 14].
Birt-Hogg-Dubé (BHD) syndrome (MIM 135150) is a rare condition with autosomal dominant inheritance caused by germline pathogenic/likely pathogenic variants (collectively
referred to as pathogenic variants herein) in the FLCN gene [15]. This syndrome is characterized by multiple skin papules of the hamartoma type on the head and neck (i.e., fibrofollicu- lomas and trichodiscomas), pulmonary cysts which can lead to spontaneous pneumothoraces, as well as several types of renal epithelial neoplasms [15, 16]. The most common BHD syn- drome-related renal neoplasms include hybrid chromophobe/ oncocytoma with a rate of 50% and chromophobe subtype with a rate of 33%; other less common tumors are clear cell, oncocytomas, and papillary subtypes [4, 15, 17].
Very few reports have suggested the exceptional asso- ciation of adrenal cortical neoplasm in BHD syndrome (Table 1) [4, 16, 18-22]. With the exception of a single case of ACC, other studies did not investigate the combi- nation of germline and tumor testing to support the role of the FLCN pathogenic variant in affected patients [4]. How- ever, information on variant allele fraction (VAF) in the tumor was not available in the index case, which precluded any mechanism supporting loss of heterozygosity (LoH) [23]. Here, we report a FLCN-related functional ACC in a
| (NM_144997.7) FLCN germline variantª (exon) | Tumor studies (VAF) | Gender (age)b | Adrenal cortical neoplasm | Other manifestations | Family history suggestive of BHD syndrome | Ref |
|---|---|---|---|---|---|---|
| c.694C>T (p.Gln232Ter) (exon 7) | Yes (83%) | F (50) | Functional adrenal cortical carcinoma with metastatic spread | Facial hirsutism Two facial papules/ angiofibromas Bilateral renal cyst Bilateral lung cyst | None | Current case |
| c.1533G> A (p.Trp511Ter) (exon 13) | No | M (33) | Non-functional adrenal cortical adenoma | Pneumothorax | None | [21] |
| c.1252del (p.Leu418fs) (exon 11) | No | F (62) | Non-functional oncocytic adrenal cortical tumor of uncertain malignant potential | Trichodiscoma | 1 TDR with pneumothorax | [20] |
| c.1285dup (p.His429fs) (exon 11) | No | M (32) | Non-functional oncocytic adrenal cortical adenoma (oncocytoma) | Pneumothorax | 1 FDR with kidney cancer, 40 y.o | [19] |
| c.941_942del (p.Pro314fs) (exon 9) | No | F (30) | Adrenal cortical carcinoma (functional status not reported) | Fibrofolliculomas Bilateral lung cysts Pneumothorax | 2 FDR and 1 SDR with skin papules and pneumothorax | [18] |
| c.1285dup (p.His429fs) (exon 11) | c | M (38) | Functional adrenal cortical carcinoma | Fibrofolliculomas Lung cysts Colonic adenoma Thyroid nodule | ND | [4] |
ND no data, FDR first degree relative, SDR second degree relative, TDR third degree relative, y.o. years-old ªOur case report and cases from peer-reviewed articles focused on primary adrenal neoplasms with a reported pathogenic or likely pathogenic variant in FLCN gene are included in this table
b Age of onset, reported in the reference (pneumothoraces or adrenal cortical carcinoma or other related manifestation)
“No information about VAF or second-hit analyses. Somatic NGS revealed FLCN c1285dup, IDH2 c.5332C>T, PRKARIA c.1074del, and PDGFRB c.3282C> A, and concurrent transcriptomic analysis demonstrated VEGFA overexpression. Microsatellite stable
50-year-old female with BHD syndrome to expand on the endocrine manifestations of this syndrome. This report also provides a review of the literature with respect to adrenal pathologies identified in patients with BHD syndrome.
Case Report
Clinical Presentation
A 50-year-old woman presented with abdominal pain and facial hirsutism. A CT scan of the abdomen detected a nearly 17 cm right adrenal mass (Fig. 1) for which she underwent a surgical adrenalectomy. Serum electrolytes and cortisol on the day of the surgery were unremarkable: potassium 3.9 mmol/L (reference range 3.5-5.0 mmol/L), sodium 138 mmol/L (reference range 135-147 mmol/L), cortisol 511 nmol/L (reference range 1600-2000 nmol/L), and cre- atinine 65 umol/L (reference range 44-106 umol/L). The patient denied any symptoms suggestive of adrenal hor- mone hypersecretion including muscle weakness, severe fatigue, palpitations, high blood pressure, or hyperglyce- mia. She did have mild hirsutism which improved after sur- gery. A complete hormonal profile and staging CT scans of the chest, abdomen, and pelvis were arranged, as well as germline genetic panel testing subsequent to the patho- logical diagnosis of adrenal cortical carcinoma. Two months post-adrenalectomy, biochemical investigations included serum: ACTH 3.8 pmol/L (reference range < 10.2 pmol/L), DHEAS 1.4 umol/L (reference range 1.5-7.7 pmol/L), cor- tisol 295 nmol/L (reference range 101-536 nmol/L), tes- tosterone 0.3 nmol/L (reference range 0.4-1.9), potassium 4.2 mmol/L (reference range 3.2-5.0 mmol/L), and sodium 138 mmol/L (reference range 135-145 mmol/L) were nor- mal. Additionally, serum normetanepherine (0.32; refer- ence range <0.89 nmol/L), metanepherine (0.07; reference range <0.49 nmol/L)), and 3 methoxytyramine (0.07; refer- ence range < 0.29 nmol/L) were normal. Interestingly, a stag- ing CT scan of the chest identified multiple thin-walled cysts within both lungs, interpreted radiologically as either lym- phangioleiomyomatosis- or BHD-related lesions (Fig. 2).
Pathological Findings
The adrenalectomy specimen weighed 2354 g and showed an adrenal cortical mass measuring a 17.5x 16.5x12 cm. The submitted sections from the mass revealed an adrenal cortical carcinoma (Fig. 3) with microscopic vascular inva- sion (venous angioinvasion) and tumor necrosis. The tumor showed focal adrenal capsule invasion without evidence of extra-adrenal tumor invasion into peri-adrenal adipose tis- sue or surrounding anatomic structures (pT2 disease, based on the 8th edition of the AJCC TNM staging system). In one section, the tumor extended to the cauterized external
PHL
AFR
45 of 105
surface corresponding to a grossly defined partial defect. The tumor displayed intra-tumoral proliferative heterogene- ity including 22 mitoses per 10 mm2 in high mitotic density areas. This finding warranted a high-grade adrenal corti- cal carcinoma based on the mitotic tumor grading scheme.
GO
Several atypical mitotic figures were noted. The Gordon- Sweet silver histochemistry showed prominent quantitative reticulin alteration characterized by loss of reticulin frame- work (Fig. 4A). There was also a very focal qualitative (peri- cellular mesh-like) reticulin staining (Fig. 4B). The Helsinki and Weiss scores were 29.13 and 8, respectively. The criteria for malignancy were also met from the reticulin algorithm.
Additional immunohistochemical biomarkers performed to further characterize this tumor showed positivity for SF1 (steroidogenic factor-1) (Fig. 5A), calretinin (variable), and low-molecular weight keratin (variable) and negativ- ity for Melan-A, chromogranin-A, and alpha-inhibin. These findings confirmed the adrenal cortical origin. While the assessment of p53 was technically suboptimal due to tissue fixation, areas with preserved tissue fixation did not show abnormal p53 reactivity (Fig. 5B). There was no nuclear beta-catenin expression (Fig. 5C). The MIB1 (Ki67) labeling index was 21.7% in hot spots using a Leica Biosystems auto- mated image analysis nuclear algorithm (Fig. 5D). There was no mismatch repair (MMR) deficiency measured for MLH1, PMS2, MSH2, and MSH6 proteins. There was nei- ther atrophy nor associated cortical nodular disease in the limited non-tumorous adrenal cortex.
Germline Genetic Testing
Her personal and family histories were unremarkable for pneumothoraces or cutaneous abnormalities. Her mother was diagnosed with melanoma at age 50 years and ovarian cancer at age 54 years, and her father was diagnosed with colon cancer at 67 years. Maternal uncle and grandmother were reportedly diagnosed with stomach and bowel cancers after 50 years, and multiple third to fourth degree relatives in the same lineage were diagnosed with breast cancer.
Germline genetic testing of 32 genes associated with both breast or renal cancers was conducted (ATM, BAP1, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, EPCAM, FH, FLCN, HOXB13, MET, MITF, MLH1, MSH2, MSH6, PALB2, PMS2, PTEN, RAD51C, RAD51D, SDHA, SDHAF2, SDHB, SDHC, SDHD, STK11, TP53, TSC1, TSC2, and VHL). This revealed a heterozygous nonsense variant in the FLCN gene NM_144997.7 c.694C> T (p.Gln232Ter). This variant is not reported in the literature, and neither in popula- tion (gnomAD, ESP, dbSNP) or clinical databases (Clin Var). It is expected to create a stop codon in exon 7, resulting in premature protein truncation and nonsense-mediated mRNA decay, and fulfills ACMG/AMP variant criteria: PVS1-null
A
B
C
C
0
variant, PM2-absent from controls, and PP3-computational evidence support deleterious effect (https://wintervar.wglab. org/). Cascade testing in family members was recommended for the FLCN variant. Given her genetic diagnosis of BHD syndrome, the patient had a complete dermatologic examina- tion that revealed consistent cutaneous findings, including one nasal angiofibroma and one fibrous papule on the right ala. At 1-year follow-up, abdominal CT scans showed bilat- eral renal cysts. Finally, given her family history of colon cancer and breast cancer, the patient was recommended to have colon cancer screening and breast imaging.
Clinical Management and Follow-Up
The patient was started on adjuvant mitotane therapy with gradual dose titration up to 1500 mg orally twice a day, which was supplemented by hydrocortisone. Unfortunately, mitotane was not tolerated due to severe nausea and vomit- ing leading to discontinuation after 2 months. Her serum mitotane levels remained subtherapeutic. Shortly after, a follow-up chest CT detected new and increasing bilateral
nodules consistent with progressive pulmonary parenchy- mal metastases (Fig. 2). Mitotane was then restarted at a dose reduction, which again was not tolerated and later led to treatment discontinuation. She developed a solitary T11 bone metastasis 3 months after re-starting mitotane causing severe pain, and was treated with 24 Gy of radiation. She continues to have close surveillance.
She was referred for respirology surveillance of her asymptomatic pulmonary cysts. Pulmonary function test- ing was normal with no exercise limitations.
Tumor Genetic Testing
Given the progression towards a metastatic disease, the patient was enrolled in the Ontario-wide Cancer Targeted Nucleic Acid Evaluation (OCTANE), a clinical trial for genomic sequencing of metastatic solid tumors using a 555-gene panel [24]. The results from her tumor testing revealed the same germline variant in FLCN: c.694C>T (p.Gln232Ter) at a VAF of 83% as well as a variant in the ATRX gene (NM_000489.6), denoted as c.1991_2016delTGA
A
B
GGCGACCGACAGAAACTAACCCT (p.Leu664fsTer4) with a VAF of 48%. Tumor was microsatellite stable.
Discussion
BHD syndrome is an autosomal dominant condition caused by germline pathogenic/likely pathogenic variants in the FLCN gene. BHD syndrome is characterized by a triad of cutaneous, pulmonary, and renal manifestations, but adrenal lesions are not a cardinal feature of this inherited condition. With the exception of a previous BHD case of ACC, no somatic tumor genetic testing data were available to support the link between the adrenal cortical neoplasia and BHD syndrome (Table 1).
Gene disease association in hereditary cancer can be more definitively elucidated with paired tumor-normal genetic studies where a two-hit mechanism can support causality (including: second-hit, loss of heterozygosity (LoH)) [23]. However, only one case report included a paired tumor-normal tissue genetic analysis to support the role of the FLCN pathogenic variant as a driver in ACC, but VAF in the tumor was not available, precluding definitive support for causality [4]. The current case expands on this association by defining a VAF of 83% in the tumor for the nonsense variant FLCN: c.694C> T (p.Gln232Ter), which further supports its role in the pathogenesis of a functional high-grade ACC in an adult patient with BHD syndrome. Further clinical investigation of this case revealed the
A (SF1)
B (p53)
D (MIB1)
C (Beta-catenin)
identification of innumerable lung cysts, which is consistent with the genetic diagnosis of BHD syndrome in this patient.
Some recurrent alterations in TP53, ZNFR3, CTNNB1, PRKAR1A, CCNE1, TERF2, CDKN2A, RB1, and MEN1 are well-known driver genes or important contributors to the pro- gression of ACC [13, 14]. Regarding the tumor mutations identified in this high-grade adrenal cortical carcinoma in our patient, in the FLCN and ATRX genes, both are of interest with respect to clinicopathological features of this case. The ATRX gene encodes a protein that contains an ATP/helicase domain and belongs to the SWI/SNF family of chromatin remodeling proteins and has a role in telomere structural maintenance [13, 25, 26]. Alterations in ATRX have been recognized in a subset of biologically aggressive forms of ACCs [7, 27, 28].
The FLCN gene encodes the protein folliculin, which is implicated in multiple cellular processes and forms a com- plex with interacting proteins 1 and 2 (FNIP-1 and FNIP-2); this FLCN/FNIP complex contributes to maintaining homeo- stasis by coordinating the opposite roles of mTORC1 and AMPK pathways in cellular metabolism [29, 30]. On one hand, mTORC1 is active when the energetic conditions in the cell are favorable to grow and proliferate, promoting the synthesis of protein, lipids, and nucleotides, and deregulation of mTORC1 has been associated with cancer metabolic and neurodevelopmental disorders [29, 30]. FLCN inactivation results in the constitutive activation of AMPK. Given the role of AMPK as a sensor and regulator of cellular energy homeostasis and survival of mammalian cells, it is expected that AMPK activation could have a pro-survival role in can- cer cells during the energy demand/supply imbalance under hypoxic and nutrient-deficient conditions typically seen in tumor microenvironment [31]. Genomic analyses of ACCs have shown that overexpression of IGF2 and constitutive activation of Wnt/ß-catenin signaling are the most frequent alterations in these tumors, along with inactivation of the TP53/RB pathway [13, 14, 32, 33]. To better understand the interplay of many of these molecular mechanisms in the pathogenesis of ACC, an animal model consisting of trans- genic mice with adrenocortical specific expression of SV40 large T-antigen (AdTAg mice) was developed. Not only did it allow it to recapitulate known frequent alterations in ACC, but they further identified mTORC1 pathway activation as a relevant alteration in both mouse and human ACC [32]. The authors hypothesized that inactivation of p53 may impair the inhibition of IGF1/AKT/mTOR pathway and suggested that mTORC1 inhibitors may be a good therapeutic strategy in ACC [32].
Conclusion
Here, we reviewed the literature of adrenal cortical neopla- sia seen in patients with BHD syndrome. We also described the first case of comprehensive tumor-normal tissue genetic
testing implicating FLCN as a potentially significant con- tributor to ACC tumorigenesis in an adult patient with BHD syndrome. Based on previous reports and our case presented here, individuals with ACC should have broad-based panel testing that includes the FLCN gene. As more cases are uncovered in future, the data may also help us to further justify the role of screening for adrenal cortical neoplasia in patients with BHD syndrome.
Acknowledgements This study was conducted with the support of the Ontario Institute for Cancer Research through funding provided by the Government of Ontario and by the Princess Margaret Cancer Foundation. RHK is supported by the Princess Margaret Foundation, the Bhalwani Family Charitable Foundation and the FDC Foundation.
Author Contribution Conception and design: Raymond Kim, Ozgur Mete, and Renee Hofstedter; data collection and analysis: Renee Hofstedter, Maria Carolina Sanabria Salas, Maria di Jiang, Shereen Ezzat, Ozgur Mete, and Raymond Kim; manuscript preparation and editing: Renee Hofstedter, Maria Carolina Sanabria Salas, and Ozgur Mete; approval of final manuscript: all authors.
Availability of Data and Materials All data generated during this study are included in this article. Specific requests should be made to the first author of this paper.
Declarations
Ethics Approval Ethical approval for the OCTANE study was obtained by the Ontario Cancer Research Ethics Board, OCREB (CAPCR 16-5655; Submitted 2016/06/10).
Consent to Participate Informed consent was obtained from the patient to be enrolled in the OCTANE study.
Consent for Publication Informed consent was obtained from the patient for the publication of this case report.
Conflict of Interest Dr. Ozgur Mete is the Editor-in-Chief of Endo- crine Pathology. This article was handled by an independent senior editor. The other authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
References
1. Sharma E, Dahal S, Sharma P, Bhandari A, Gupta V, Amgai B, Dahal S. The Characteristics and Trends in Adrenocortical Carci- noma: A United States Population Based Study. Journal of clinical medicine research. 2018;10(8):636-640.
2. Else T, Kim AC, Sabolch A, Raymond VM, Kandathil A, Caoili EM, Jolly S, Miller BS, Giordano TJ, Hammer GD. Adrenocorti- cal Carcinoma. Endocrine Reviews. 2014;35(2):282-326.
3. Gallinger B, Druker H, Gill AJ, Wasserman JD, Kim RH. The adrenal gland: an evolution of the roles of genetic counsellors and medical geneticists in endocrine cancers. Diagnostic Histopathol- ogy. 2016;22(3):108-122.
4. Kim D, Murvelashvili N, Hamidi O, Jia L. Adrenal Cortical Carcinoma and Additional Rare Pathologic Findings in Multi-Organs in a Birt- Hogg-Dubé Syndrome Patient: With an Emphasis on the Molecular Characteristics of Adrenal Cortical Carcinoma. International journal of surgical pathology. 2022:10668969221117246.
5. Else T. Association of adrenocortical carcinoma with familial cancer susceptibility syndromes. Molecular and cellular endocri- nology. 2012;351(1):66-70.
6. Else T, Lerario AM, Everett J, Haymon L, Wham D, Mullane M, Wilson TL, Rainville I, Rana H, Worth AJ, Snyder NW, Blair IA, Mckay R, Kilbridge K, Hammer G, et al. Adrenocortical carci- noma and succinate dehydrogenase gene mutations: an observa- tional case series. Eur J Endocrinol. 2017;177(5):439-444.
7. Juhlin CC, Bertherat J, Giordano TJ, Hammer GD, Sasano H, Mete O. What Did We Learn from the Molecular Biology of Adre- nal Cortical Neoplasia? From Histopathology to Translational Genomics. Endocr Pathol. 2021;32(1):102-133.
8. Mete O, Erickson LA, Juhlin CC, de Krijger RR, Sasano H, Volante M, Papotti MG. Overview of the 2022 WHO Classification of Adre- nal Cortical Tumors. Endocr Pathol. 2022;33(1):155-196.
9. Xie C, Tanakchi S, Raygada M, Davis JL, Del Rivero J. Case Report of an Adrenocortical Carcinoma Associated With Ger- mline CHEK2 Mutation. J Endocr Soc. 2019;3(1):284-290.
10. El Ghorayeb N, Grunenwald S, Nolet S, Primeau V, Côté S, Maugard CM, Lacroix A, Gaboury L, Bourdeau I. First case report of an adreno- cortical carcinoma caused by a BRCA2 mutation. Medicine (Balti- more). 2016;95(36):e4756.
11. Torres MB, Diggs LP, Wei JS, Khan J, Miettinen M, Fasaye GA, Gillespie A, Widemann BC, Kaplan RN, Davis JL, Hernandez JM, Rivero JD. Ataxia telangiectasia mutated germline pathogenic variant in adrenocortical carcinoma. Cancer Genet. 2021;256-257:21-25.
12. Landwehr LS, Schreiner J, Appenzeller S, Kircher S, Herterich S, Sbiera S, Fassnacht M, Kroiss M, Weigand I. A novel patient- derived cell line of adrenocortical carcinoma shows a pathogenic role of germline MUTYH mutation and high tumour mutational burden. Eur J Endocrinol. 2021;184(6):823-835.
13. Assié G, Letouzé E, Fassnacht M, Jouinot A, Luscap W, Barreau O, Omeiri H, Rodriguez S, Perlemoine K, René-Corail F, Elarouci N, Sbiera S, Kroiss M, Allolio B, Waldmann J, et al. Integrated genomic characterization of adrenocortical carcinoma. Nature Genetics. 2014;46(6):607-612.
14. Zheng S, Cherniack AD, Dewal N, Moffitt RA, Danilova L, Murray BA, Lerario AM, Else T, Knijnenburg TA, Ciriello G, Kim S, Assie G, Morozova O, Akbani R, Shih J, et al. Com- prehensive Pan-Genomic Characterization of Adrenocortical Carcinoma. Cancer Cell. 2016;29(5):723-736.
15. Warren MB, Torres-Cabala CA, Turner ML, Merino MJ, Matrosova VY, Nickerson ML, Ma W, Linehan WM, Zbar B, Schmidt LS. Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc. 2004;17(8):998-1011.
16. Reese E, Sluzevich J, Kluijt I, Teertstra HJ, De Jong D, Horenblas S, Ryu J, Birt-Hogg-Dubé Syndrome, in Cancer Syndromes, D.L. Riegert- Johnson, L.A. Boardman, and T. Hefferon, Editors. 2009, National Center for Biotechnology Information (US): Bethesda (MD).
17. Woodford MR, Andreou A, Baba M, van de Beek I, Di Malta C, Glykofridis I, Grimes H, Henske EP, Iliopoulos O, Kurihara M, Lazor R, Linehan WM, Matsumoto K, Marciniak SJ, Namba Y, et al. Seventh BHD international symposium: recent scientific and clinical advancement. Oncotarget. 2022;13:173-181.
18. Kalloniati E, Antoniades E, Athanasouli F. Birt-Hogg-Dubé Syndrome and coexistence with adrenocortical carcinoma. Hip- pokratia. 2021;25(1):49-49.
19. Ramsingh J, Watson C. Oncocytoma of the adrenal gland in Birt- Hogg-Dube syndrome. BMJ case reports. 2018;2018.
20. Raymond VM, Long JM, Everett JN, Caoili EM, Gruber SB, Stoffel EM, Giordano TJ, Hammer GD, Else T. An oncocytic adrenal tumour in a patient with Birt-Hogg-Dubé syndrome. Clinical endocrinology. 2014;80(6):925-7.
21. Kunogi M, Kurihara M, Ikegami TS, Kobayashi T, Shindo N, Kumasaka T, Gunji Y, Kikkawa M, Iwakami S-i, Hino O, Takahashi K, Seyama K. Clinical and genetic spectrum of Birt- Hogg-Dube syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature. Journal of medi- cal genetics. 2010;47(4):281-7.
22. Juszczak A, Halliday D, Mihai R, Ali A. A large adrenal tumour as a phenotypic manifestation of the Birt-Hogg-Dube syndrome. in Endocrine Abstracts. 2011.
23. Mandelker D,Ceyhan-Birsoy O. Evolving Significance of Tumor-Normal Sequencing in Cancer Care. Trends in Cancer. 2020;6(1):31-39.
24. Malone ER, Saleh RR, Yu C, Ahmed L, Pugh T, Torchia J, Bartlett J, Virtanen C, Hotte SJ, Hilton J, Welch S, Robinson A, McCready E, Lo B, Sadikovic B, et al. OCTANE (Ontario- wide Cancer Targeted Nucleic Acid Evaluation): a platform for intraprovincial, national, and international clinical data-sharing. Curr Oncol. 2019;26(5):e618-e623.
25. Pittaway JFH,Guasti L. Pathobiology and genetics of adreno- cortical carcinoma. J Mol Endocrinol. 2019;62(2):R105-R119.
26. Pinto EM, Chen X, Easton J, Finkelstein D, Liu Z, Pounds S, Rodriguez-Galindo C, Lund TC, Mardis ER, Wilson RK, Boggs K, Yergeau D, Cheng J, Mulder HL, Manne J, et al. Genomic landscape of paediatric adrenocortical tumours. Nat Commun. 2015;6:6302.
27. Mete O, Gucer H, Kefeli M, Asa SL. Diagnostic and Prognostic Biomarkers of Adrenal Cortical Carcinoma. Am J Surg Pathol. 2018;42(2):201-213.
28. Brondani VB, Lacombe AMF, Mariani BMP, Montenegro L, Soares IC, Bezerra-Neto JE, Tanno FY, Srougi V, Chambo JL, Mendonca BB, Almeida MQ, Zerbini MCN, Fragoso MCBV. Low Protein Expression of both ATRX and ZNRF3 as Novel Negative Prognostic Markers of Adult Adrenocortical Carcinoma. Int J Mol Sci. 2021;22(3).
29. Ramirez Reyes JMJ, Cuesta R, Pause A. Folliculin: A Regulator of Transcription Through AMPK and mTOR Signaling Pathways. Front Cell Dev Biol. 2021;9:667311.
30. De Martino MC, Feelders RA, Pivonello C, Simeoli C, Papa F, Colao A, Pivonello R, Hofland LJ. The role of mTOR pathway as target for treatment in adrenocortical cancer. Endocr Connect. 2019;8(9):R144-R156.
31. Liang J,Mills GB. AMPK: a contextual oncogene or tumor sup- pressor? Cancer Res. 2013;73(10):2929-35.
32. Batisse-Lignier M, Sahut-Barnola I, Tissier F, Dumontet T, Mathieu M, Drelon C, Pointud JC, Damon-Soubeyrand C, Marceau G, Kemeny JL, Bertherat J, Tauveron I, Val P, Martinez A, Lefrançois-Martinez AM. P53/Rb inhibition induces meta- static adrenocortical carcinomas in a preclinical transgenic model. Oncogene. 2017;36(31):4445-4456.
33. Juhlin CC, Goh G, Healy JM, Fonseca AL, Scholl UI, Stenman A, Kunstman JW, Brown TC, Overton JD, Mane SM, Nelson- Williams C, Bäckdahl M, Suttorp AC, Haase M, Choi M, et al. Whole-exome sequencing characterizes the landscape of somatic mutations and copy number alterations in adrenocortical carci- noma. J Clin Endocrinol Metab. 2015;100(3):E493-502.
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.