ENDOCRINE SOCIETY
OXFORD
Nicotinamide Nucleotide Transhydrogenase Is Essential for Adrenal Steroidogenesis: Clinical and In Vitro Lessons
Aline Faccioli Bodoni,1 .* Fernanda Borchers Coeli-Lacchini,2,* Juliana Lourenço Gebenlian,1 Lays Martin Sobral,3 Cristiana Bernadelli Garcia,3 Wilson Araújo Silva Jr,4,5,6 Kamila Chagas Peronni,4,5,6 Leandra Naira Zambelli Ramalho,7 Fernando Silva Ramalho,7 Ayrton C. Moreira,2 Margaret de Castro,2 Andreia Machado Leopoldino,3 and Sonir Roberto Rauber Antonini10D
1Department of Pediatrics, Ribeirao Preto Medical School, University of Sao Paulo, Ribeirao Preto, SP 14049-900, Brazil
2Department of Internal Medicine, Ribeirao Preto Medical School, University of Sao Paulo, Ribeirao Preto, SP 14049-900, Brazil
3Department of Clinical Analysis, Toxicology and Food Sciences, School of Pharmaceutical Sciences of Ribeirao Preto, University of Sao Paulo, Ribeirao Preto, SP 14049-900, Brazil
4Department of Genetics, Ribeirao Preto Medical School, University of Sao Paulo (USP), Ribeirao Preto, SP 14049-900, Brazil
5Center for Cell Based Therapy, Ribeirao Preto Medical School, University of Sao Paulo (USP), Ribeirao Preto, SP 14049-900, Brazil
6Center for Medical Genomics at Clinical Hospital of the Ribeirao Preto Medical School, University of São Paulo, Ribeirao Preto, SP 14049-900, Brazil
7Department of Pathology and Forensic Medicine, School of Medicine of Ribeirao Preto, University of Sao Paulo, Ribeirao Preto, SP 14049-900, Brazil
Correspondence: Sonir R. Antonini, MD, PHD, Ribeirao Preto Medical School, University of Sao Paulo, Avenida Bandeirantes, 3900 Monte Alegre, CEP14049-900 Ribeirao Preto, Sao Paulo, Brazil. Email: antonini@fmrp.usp.br.
*These authors have contributed equally to this work.
Abstract
Context: Nicotinamide nucleotide transhydrogenase (NNT) acts as an antioxidant defense mechanism. NNT mutations cause familial glucocorticoid deficiency (FGD). How impaired oxidative stress disrupts adrenal steroidogenesis remains poorly understood.
Objective: To ascertain the role played by NNT in adrenal steroidogenesis.
Methods: The genotype-phenotype association of a novel pathogenic NNT variant was evaluated in a boy with FGD. Under basal and oxidative stress (OS) induced conditions, transient cell cultures of the patient’s and controls’ wild-type (WT) mononuclear blood cells were used to evaluate antioxidant mechanisms and mitochondrial parameters (reactive oxygen species [ROS] production, reduced glutathione [GSH], and mitochondrial mass). Using CRISPR/Cas9, a stable NNT gene knockdown model was built in H295R adrenocortical carcinoma cells to determine the role played by NNT in mitochondrial parameters and steroidogenesis. NNT immunohistochemistry was assessed in fetal and postnatal human adrenals.
Results: The homozygous NNT p.G866D variant segregated with the FGD phenotype. Under basal and OS conditions, p.G866D homozygous mononuclear blood cells exhibited increased ROS production, and decreased GSH levels and mitochondrial mass than WT NNT cells. In line H295R, NNT knocked down cells presented impaired NNT protein expression, increased ROS production, decreased the mitochondrial mass, as well as the size and the density of cholesterol lipid droplets. NNT knockdown affected steroidogenic enzyme expression, impairing cortisol and aldosterone secretion. In human adrenals, NNT is abundantly expressed in the transition fetal zone and in zona fasciculata.
Conclusion: Together, these studies demonstrate the essential role of NNT in adrenal redox homeostasis and steroidogenesis.
Key Words: adrenal insufficiency, FGD, NNT, mutations, CRISPR/Cas9
Abbreviations: ATP, adenosine triphosphate; DHEA, dehydroepiandrosterone; FGD, familial glucocorticoid deficiency; FSK, forskolin; GSH, reduced glutathione; GSSG, oxidised glutathione (GSSG); H2O2, hydrogen peroxide; LH, luteinizing hormone; MC2R, melanocortin-2 receptor; MCM4, mini-chromosome maintenance-deficient 4 homolog gene; MRAP, MC2R accessory protein; NNT, nicotinamide nucleotide transhydrogenase; 02, superoxide anion; OS, oxidative stress; PCR, polymerase chain reaction; ROS, reactive oxygen species; STAR, steroidogenic acute regulatory; TXNRD2, thioredoxin reductase 2; WT, wild type.
Familial glucocorticoid deficiency (FGD) is a rare autosomal re- cessive disorder characterized by glucocorticoid and adrenal androgen deficiency in the absence of mineralocorticoid defi- ciency or with a slight mineralocorticoid impairment. In their first years of life, patients with FGD usually present with severe hypoglycemia, arterial hypotension, and circulatory shock (1).
FGD is caused by mutations affecting the melanocortin-2 receptor (MC2R, OMIM: 607397) or the MC2R accessory protein (MRAP, OMIM: 609196) coding genes (2). Less frequently, FGD results from mutations in the steroidogenic acute regulatory gene (STAR, OMIM: 600617), the mini-chromosome maintenance-deficient 4 homolog gene
(MCM4, OMIM: 602638), and thioredoxin reductase 2 (TXNRD2, OMIM: 606448). More recently, mutations in nicotinamide nucleotide transhydrogenase (NNT, OMIM: 607878) have also been associated with FGD (3-5).
The NNT protein is expressed in the inner mitochondrial membrane and is essential for maintaining redox balance. When energy is generated in the form of adenosine triphos- phate (ATP), a small percentage of molecular oxygen is con- verted to superoxide anion (O2) radicals, which are then converted to hydrogen peroxide (H2O2) by superoxide dismu- tase (6). Mitochondrial H2O2 is further reduced by 2 major thiol antioxidant systems that depend on reduced glutathione (GSH) and the small protein thioredoxin 2. Both the thiore- doxin 2 and the GSH system depend on the reducing power of NADPH. The NNT proton pump maintains NADPH sup- ply within the mitochondria. Disturbances in the antioxidant pathways can induce oxidative stress, resulting in deleterious effects on proteins, lipids, and nucleic acids, ultimately dam- aging the cells (7).
Disturbances in redox homeostasis within the adrenocort- ical environment may impair steroidogenesis, but the precise mechanism underlying this impairment is not entirely under- stood. Intramitochondrial NADPH is required in the adrenal steroidogenesis mitochondrial steps. Cholesterol is con- verted to pregnenolone inside mitochondria; this conversion is the first rate-limiting, hormonally regulated step in the syn- thesis of all steroid hormones. In this process, the ferredoxin reductase flavin group, bound to inner mitochondrial mem- brane, accepts 2 electrons from NADPH, converting it to NADP+. Ferredoxin then donates the electrons to the P450 heme (8, 9).
Certain C57BL/6J mouse substrains contain a spontaneous Nnt mutation and have been reported to show important re- dox alterations, including absence of transhydrogenation be- tween NAD and NADP, low capacity to metabolize peroxide, spontaneous NADPH oxidation, and changes in glutathione system functioning (10).
Transient NNT knockdown in the human adrenocortical cell line H295R increases mitochondrial reactive oxygen spe- cies (ROS) levels and apoptosis, and lowers the GSH/oxi- dised glutathione (GSSG) ratio (3). The first functional analysis of a NNT mutant concerned fibroblasts from an af- fected patient and revealed increased ROS and decreased ATP levels, as well as defective mitochondrial function (11). Another functional study analyzed lymphocytes from family carriers of the NNT p.F215S mutation and showed significant NNT activity loss of function (12). Few FGD pa- tients harboring NNT mutations have been reported to date, most of them presenting with glucocorticoid but not aldos- terone deficiency. However, mineralocorticoid phenotype deficiency was reported in a few of these patients. The reason why mineralocorticoid production is generally unaffected in most patients with NNT loss-of-function mutations is unknown.
We had the opportunity to evaluate a boy presenting clin- ical and biochemical findings of FGD whose diagnosis was confirmed by the presence of a new homozygous variant of NNT, p.G866D. Here, we present data on the evaluation of how the new p.G866D NNT variant impacts oxidative stress and mitochondrial function. In addition, we have also generated NNT-deficient adrenocortical cells by CRISPR/Cas9 to understand the role played by NNT in ad- renal steroidogenesis.
Materials and Methods Patient
An 18-month-old Brazilian boy born to a consanguineous family presented with hypoglycemia (55 mg/dL), seizures, skin hyperpigmentation, and normal external genitalia. Laboratory evaluation showed undetectable plasma corti- sol level (<33.1 nmol/L/ <1.2 µg/dL), elevated adrenocor- ticotropin (>0.275 pmol/L/> 1.250 pg/mL), undetectable 17-OH progesterone (<0.11 nmol/L/<3.9 ng/dL), nor- mal Na (134 mEq/L), normal K (5.0 mEq/L), and slightly elevated plasma renin activity (4.2 ng/ml/hour). The clin- ical phenotype of this patient and the laboratory data pre- senting with primary adrenal insufficiency without increased 17-OH progesterone and without mineralocor- ticoid deficiency was consistent with FGD. His first-degree cousin parents and his younger brother were clinically asymptomatic. Glucocorticoid replacement was started at the diagnosis with excellent outcome. Since then, the patient has presented normal Na, K, and plasma renin ac- tivity, or direct renin levels in the upper normal range or slightly elevated. Besides the involvement of the zona fas- ciculata, the zona reticularis was affected, as shown by un- detectable or very low dehydroepiandrosterone (DHEA) sulfate plasma levels and the lack of adrenarche, consider- ing that the patient is already 15 years old. Testicular de- velopment and steroidogenesis were preserved in this patient, as shown by progressive testicular enlargement associated with pubertal plasma luteinizing hormone (LH) and testosterone levels since the age of 13 years (Table S1 (13)). Routine ultrasound evaluation performed yearly has not shown testicular adrenal rest tumours but revealed non-progressive microlithiasis in the left testicle.
This study was approved by the University Hospital of the Ribeirao Preto Medical School, University of Sao Paulo (HC-FMRP-USP) Ethics Committee (#1.428.432/2016) and a signed statement of informed consent was obtained from the parents of pediatric patients and the relatives of controls.
Whole Exome Sequencing
Genomic DNA was obtained from the patient’s peripheral blood and isolated using the QIAamp DNA blood kit (Qiagen). DNA purity was analyzed by fluidic electrophoresis with the Agilent DNA 12000 kit (2100 Bioanalyzer). DNA was quantified by fluorometry with the Qubit dsDNA HS Assay kit (Thermo Fisher Scientific), on a Qubit 2.0 Fluorometer (Thermo Fisher Scientific). After mutations in the 2 main candidate genes-MC2R and MRAP-were ruled out by Sanger sequencing, exome sequencing was performed as follows. The library for target seq was prepared according to the manufacturer’s instructions, captured in solution with the TargetSeq Exome Enrichment System (Applied Biosystems, Thermo Fisher Scientific), and sequenced on the Life Technologies 5500 SOLID System. Raw data were proc- essed by using the following steps: (1) reads were aligned to the hg19 reference genome by using the SOLID LifeScope soft- ware; (2) variant sequences were screened using the Genome Analysis Tool Kit followed by an in-house sequential proto- col: dbNSFP version 2.4, COSMIC v69, 1000genomes, ESP version ESP6500SI-V2, HapMap, and dbSNP version 138. In addition, patient data were compared with the controls;
(3) the detected variants were manually checked with the Integrative Genome Viewer (IGV software; Broad Institute).
Sanger Sequence
The p.G866D NNT variant (ENSG00000112992) was con- firmed by Sanger direct sequencing. The following NNT pri- mers were used during the polymerase chain reaction PCR and sequencing: forward 5’-TTATGTTATTAATTTT GAGTTCTGA-3’ and reverse 5’-AATATACAACACGA TCAGACA-3’. The results were analyzed using Chromas and CodonCode Aligner software.
Immunohistochemistry
For immunohistochemistry analysis, normal human fetal and postnatal adrenal cortices were obtained from spontaneously miscarried fetuses submitted for autopsy at the Department of Pathology, Ribeirao Preto Medical School, as described previ- ously (14). This study was approved by the HC-FMRP-USP Ethics Committee (#2.911.367/2018).
To ascertain NNT expression in normal developing and adult steroidogenic tissues, immunohistochemistry analysis for the NNT protein was performed in a subset of 9 samples. Rabbit polyclonal anti-NNT primary antibody (dilution 1:200; RRID:AB1079495) was used, followed by signal detec- tion with the REVEAL Biotin-Free Polyvalent horseradish peroxidase kit (REVEAL, Amsbio). Labeling was developed with 3,3-diaminobenzine (Vector Laboratories Inc.), and the sections were counterstained with Harris hematoxylin. Hematoxylin-eosin staining confirmed human tissue histo- morphology. A descriptive analysis is presented.
Analysis of How the New NNT Mutation Impacts Oxidative Stress and Mitochondrial Function
Transient mononuclear blood cell culture
Mononuclear peripheral blood cells obtained from the af- fected patient (homozygous), his mother (heterozygous), and controls (WT) were isolated from 15 mL of venous blood col- lected with heparin using Histopaque (Sigma-Aldrich).
Mononuclear blood cells were maintained in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco) under stand- ard conditions at 37 ℃ and 5% CO2. After culturing for 48 hours, the cells were stimulated with H2O2 (final concen- tration = 100 µM) (Merck Millipore Corporation) for 5 hours to induce oxidative stress.
Analysis of NNT Action on Adrenal Steroidogenesis H295R cell culture
H295R adrenocortical carcinoma cell line (RRID: CVCL_0458) and clonal cells derived from H295R were grown in RPMI-1640 medium (Gibco) containing 2% (v/v) fe- tal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco) in a humidified incubator at 37 ℃ and 5% CO2 at- mosphere. This cell line was kindly provided by Professor Claudimara Lotfi (Institute of Biomedical Sciences, University of Sao Paulo) and was authenticated by analyzing the short tandem repeat profile and obtaining a negative test for mycoplasma contamination (15).
The medium was replaced with fresh medium containing ei- ther vehicle or test drugs such as forskolin (FSK; Sigma-Aldrich)
(final concentration = 10 µM) and N-acetylcysteine (Sigma- Aldrich) (final concentration = 1 mM). All the stock solutions of the test drugs were prepared in dimethyl sulfoxide (Sigma-Aldrich). Within an experiment, the total final concen- tration of dimethyl sulfoxide (less than 0.1%) was kept constant between conditions.
Generation of an NNT-Deficient Cell by CRISPR/Cas9
NNT-deficient H295R adrenal cells were generated by CRISPR/Cas9 in 2 steps. A commercially designed CRISPR/ Cas9 system was used (Dharmacon Edit-R Lentiviral Cas9 Nuclease, Edit-R Lentiviral sgRNAs and Edit-R Lentiviral sgRNA Non-Targeting Control). The sgRNA was applied to target the start of exon 2 of NNT. Lentivectors containing the CRISPR/Cas9 were developed and transduced into H295R cells as previously described (16). Following, trans- duced cells with Cas9 nuclease along with an insertion of the blasticidin resistance gene were selected in medium con- taining blasticidin S (5 µg/mL). The cells expressing Cas9 were transduced with lentivectors containing sgRNA for NNT or sgRNA for the nontargeting control. These vectors expressed a puromycin-resistance gene and positive cells were selected in medium containing puromycin (7.5 µg/mL). The presence of NNT knockdown was confirmed by direct se- quencing, which was analyzed using Tide software (https:// tide.nki.nl/). Generated knockout cells containing the mutated NNT gene were cloned into 100-mm plates. After 10 weeks, the clones were isolated with Scienceware cloning disks (Sigma Aldrich, St. Louis, MO, United States). Selected knockdown NNT clones were expanded and the expression of NNT protein was verified by Western blot.
Construction of the NNT Mammalian Expression Plasmids
The commercial plasmid NNT (HaloTag human ORF in pFN21A-FHC01572; Promega) containing the wild-type (WT) NNT gene sequence (NM_001331026) was used. Site-directed mutagenesis was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) with specific primers (NNT mG866D-F 5’-TGGGTGCACTCA TAGACTCGTCTGGTGCTATC and NNT mG866D-R 5’-GATAGCACCAGACGAGTCT ATGAGTGCACCCA).
Functional analyses were conducted in vitro using NNT-deficient H295R cells. These cells were transfected with the WT or the mutant p.G866D NNT plasmids using the Xfect Transfection Reagent (Takara Bio Inc).
Immunofluorescence
Cells (105) were seeded on coverslips in 24-well plates. After 24 hours, the cells were fixed in 4% formaldehyde and blocked with 1% bovine serum albumin. NNT was detected using the polyclonal rabbit antibody for NNT protein (dilu- tion: 1:200) (RRID:AB1079495) and donkey antirabbit IgG (H+L) highly cross-adsorbed secondary antibody, Alexa Fluor 488, as secondary antibody (RRID:AB_2535792). Nuclear staining was accomplished using DAPI (dilution: 1:25 000 #4083, Cell Signaling Technology), and the slides were set with ProLong Diamond (Thermo Fisher Scientific). Fluorescence was acquired with a confocal microscope (Leica SP5; Leica Microsystems). The different fluorophores were excited at 644 nm, 665 nm, 365 nm, and 405 nm.
Two independent experiments were carried out in triplicate.
Viability
Cells (3×104 per well) were seeded in 96-well plates. After 96 hours, Cell Titer 96 Aqueous One Solution (Promega) was added to each well, and the cells were incubated for 1 hour, according to the manufacturer’s instructions. Absorbance at 490 nm was read with a microplate reader (Bio-Rad). Cell viability values are demonstrated as percen- tages of control cells. Two independent experiments were car- ried out in triplicate.
Protein Isolation, Subcellular Fractionation, and Western Blot Analysis
Cells were lysed with the CelLytic M (Sigma-Aldrich), and protease and phosphatase inhibitor cocktails (P8340 and P5726, both Sigma-Aldrich) were added. The ProteoExtract subcellular proteome extraction kit (Calbiochem-Merck) was used to obtain cytosolic and membrane/organelle subfrac- tions; the manufacturer’s recommendations were followed.
Protein concentration was measured using the Qubit Protein Assay (Thermo Scientific). Equal amounts (30 µg) of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, blocked in TBST-T containing 5% blotting-grade blocker (Bio-Rad), and probed with the aforementioned anti-NNT antibody (dilution: 1:200; RRID:AB1079495). Anti-GAPDH antibody (dilution: 1:1000; RRID:AB_627678) was used as loading control. Immunocomplexes were visualized with horse- radish peroxidase-conjugated antimouse (dilution: 1:4000, RRID:AB_631736) and antirabbit (dilution: 1:3000; RRID: AB_628497) antibody and developed with enhanced chemilu- minescence kit ECL Western blotting detection reagents (GE Healthcare) on a ChemiDoc XRS + System (Bio-Rad, Hercules, CA, USA). Acquired bands were analyzed using the Image Lab software (Bio-Rad).
RNA Isolation and Quantitative Real-time PCR
Total RNA was extracted using the TRIzol Reagent (Thermo Scientific). mRNA was submitted to reverse transcription from 500 ng of total RNA using the high-capacity cDNA reverse 260 transcription kit and MultiScribe enzyme (Thermo Scientific). Quantitative real-time PCR (qPCR) was performed using the following TaqMan assays (Thermo Scientific): NNT (Hs00966097_m1), ACTB (4326315E), CYP11A1 (Hs008 97320), CYP11B1 (HS01596404), CYP11B2 (Hs0159 7732_m1), FDXR (Hs01031617), FDX1 (Hs01070065_g1), GPX1 (HS00829989), GUSB (4326320E), STAR (HS0098 6559), TBP1 (4326322E), and TXNRD2 (HS00272352). For all analyses, mRNA relative expression values were determined by the 2-44Ct method (17). GUSB and TBP1 were used as en- dogenous controls for mononuclear blood cells, and ACTB and GUSB were used as endogenous controls for H295R cells.
Mitochondrial Function Analysis
A parameter of the mitochondrial function determined was previously described (18). Intracellular ROS levels were ana- lyzed using 20,70-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Scientific). Cells were incubated with 5 µM H2DCFDA at 37 ℃ for 30 minutes and analyzed in
the BD-FACS Canto flow cytometer (Becton Dickinson), using 495-nm excitation and 527-nm emission wavelengths. Mean fluorescence intensities were analyzed with BD FACS-Diva Version 6.1.3 software (Becton Dickinson). At least 68 000 and 270 000 cells for mononuclear blood cells and H295R cells were analyzed, respectively. Two independent experi- ments were carried out in triplicate.
GSH was measured with a luminescence assay, using the GSH-Glo assay (Promega Madison, WI), according to the manu- facturer’s protocol. The cells were incubated with GSH-Glo reagent for 30 minutes, followed by incubation with luciferin detection re- agent. The cellular ATP levels were measured by luciferin-luciferase using the ATP lite luminescence assay system (Sigma-Aldrich) ac- cording to the manufacturer’s protocol. The SpectraMax luminom- eter (Molecular Devices) was used to measure luminescence. Two independent experiments were carried out in triplicate.
MitoTracker Deep Red FM (Thermo Fisher Scientific), a dye that stains mitochondria in live cells, was used to measure mito- chondrial mass. Cells were incubated with MitoTracker deep Red (250 nM) and Hoechest (1 µg/mL) or DAPI (0.5 µg/mL) at 37℃ for 30 minutes. The cells were aldehyde fixed, and mounting medium (Thermo Fisher Scientific, MA, USA) was added. Digital images were acquired with a Leica SP5 confocal microscope (Leica Microsystems). The different fluorophores were excited using the 644-nm, 665-nm, 365-nm, and 405 nm wavelengths. LAS AF version 2.7.3.9723 software (Leica Microsystems) was used for acquisition. The fluorescence inten- sity was quantified using ImageJ software (U.S. National Institutes of Health, Bethesda, MA, USA), and the average of relative fluorescence was demonstrated as mean arbitrary fluor- escence units. At least 100 and 600 cells for mononuclear blood cells and H295R cells were analyzed, respectively. Two inde- pendent experiments were carried out in triplicate.
Cell death was evaluated by determining the number of cells in the late apoptosis stage or necrosis. The cells were stained with propidium iodide (2 ug/mL; Sigma-Aldrich) and ana- lyzed using a BD-FACS Canto flow cytometer (Becton Dickinson). To determine the mean fluorescence intensity, flow cytometry analysis software BD FACS-Diva Version 6.1.3 (Becton Dickinson) (excitation 535, emission 617) was used. A total of 60 000 cells were analyzed in triplicate. Two independent experiments were carried out in triplicate.
Cholesterol Trafficking
The effect of alterations on cholesterol trafficking was eval- uated by incubating cells with NBD-cholesterol ((22-(N-(7- Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5- Cholen-3B-O1), 5 pm; Thermo Fisher Scientific) at 37 ℃ for 24 hours. Then the cells were fixed in 4% paraformaldehyde and added to mounting medium (Thermo Fisher Scientific). Digital images were acquired with a Leica SP5 confocal microscope (Leica Microsystems). The fluorophore was ex- cited using the 469-nm and 537-nm excitation lines. LAS AF version 2.7.3.9723 software (Leica Microsystems) was used for acquisition. The density and size of cholesterol lipid droplets were quantified by using ImageJ software (RRID: SCR_003070). Six hundred H295R cells were analyzed in 2 independent experiments.
Cortisol and Aldosterone Assays
The impact of NNT knockdown on the steroidogenesis of H295R cells was evaluated by measuring cortisol and
aldosterone in the cell culture medium. Cortisol was measured using an in-house-developed radioimmunoassay, as previous- ly described (19). Aldosterone was measured by enzyme- linked immosorbent assay (Aldosterone ELISA kit, catalog #ADI900-173, ENZO Lifesciences).
Statistical Analysis
Data are presented as mean ± SD or mean ± SEM. Statistical significance was determined using a Student’s t-test or 1-way analysis of variance followed by Tukey’s test. GraphPad Prism 8.0 software analyses (RRID:SCR_002798) was used for these and the level of significance was set at P ≤.05.
Results
Whole Exome Sequencing Revealed a Homozygous Loss-of-function NNT Mutation
Initially, exploratory analysis by whole exome sequencing al- lowed us to access a huge number of candidate variants (n = 681 931). We performed the first screenings to choose the rele- vant variants by using bioinformatics tools, and we added some filters to sort the genetic variants (Fig. 1 (13)). By using this approach, we reduced the number of candidate variants to 153, among which 25 variants were novel; in other words, they were not found in any public gene bank. Then we as- sessed the function of these variants by using online tools to analyze the damage probability in the coded proteins. We se- lected mutations that were classified as pathogenic in at least 3 out of 7 analyzed prediction models. After this step, 1 of these new variants, p.G866D NNT, showed a high score in prob- able damage in all online tools. We analyzed the family pedi- gree to confirm the segregation of the p.G866D variant by Sanger sequencing (Fig. 1A). We found this mutation, which corresponded to the replacement of the highly conserved gly- cine residue with aspartic acid at position 866 of the protein (Fig. 1C), to be homozygous in the index case and heterozy- gous in his asymptomatic older brother and first-degree cousin parents (Fig. 1A and 1B). Evaluation of other family members was not possible as they live in distant rural areas in another region of the country.
Analysis in Mononuclear Blood Cells Revealed Lower Mitochondrial Activity in Cells With the p.G866D Mutation
NNT mRNA expression, assessed by qPCR, did not show any differences in mRNA expression of the NNT WT mono- nuclear blood cells, the homozygous index case, and the het- erozygous carriers of the p.G866D NNT variant. Basal ROS levels were significantly higher in NNT p.G866D homozygous mononuclear blood cells than in NNT WT mononuclear blood cells (P =. 02). After oxidative stress was induced, ROS levels were further increased in p.G866D NNT homozy- gous mononuclear blood cells (P =. 0001; Fig. 2A).
We also evaluated the mitochondrial function in p.G866D NNT homozygous (obtained from the homozygous index case), heterozygous (obtained from the heterozygous carriers of the NTT p.G866D variant), and NNT WT mononuclear blood cells under basal conditions and after oxidative stress was induced. Under basal conditions, the homozygous index case had lower GSH levels than NNT WT and heterozygous carriers (P =. 01). After oxidative stress was induced, GSH
levels differed among the 3 groups: NTT WT > heterozygous carriers > homozygous index case (P =. 05; Fig. 2B).
Under basal conditions, ATP levels were not altered in p.G866D NNT homozygous mononuclear blood cells. However, after oxidative stress was induced, the ATP levels in these cells decreased significantly (P <. 0001; Fig. 2C). Similarly, although the 3 groups did not differ in terms of the viability pattern under basal conditions, oxidative stress induction significantly increased the number of dead cells in p.G866D NNT homozygous when compared with NTT WT mononuclear blood cells (P =. 009; Fig. 2D).
Figure 2E shows representative images of mitochondrial mass (in red), and nuclear integrity (in blue) in mononuclear blood cells. Under basal conditions, mitochondrial mass was significantly reduced in p.G866D NNT homozygous com- pared with NNT WT mononuclear blood cells (P =. 01, Fig. 2E). After oxidative stress induction, this difference was even more pronounced (P =. 001).
NNT Activity Is Critical for Maintaining Mitochondrial Activity and Steroidogenesis in Adrenal Cells
By using the CRISPR/Cas9 system, we established NNT-deficient H295R cells. We verified knockdown effi- ciency after direct sequencing followed by TIDE analysis. The RNA guide for exon 2 of the NNT gene showed a knock- down efficiency of 24.5% (Fig. 2B (13)). Clones were isolated and expanded, and NNT protein knockdown in each clone was confirmed by Western blot (Fig. 2C (13)).
We evaluated the capacity of NNT-deficient H295R clones to produce cortisol. Two clones showed significantly reduced cortisol production (Fig. 2E (13)) without reduction in cell viability (Fig. 2D (13)). We characterized NNT protein levels in the clone identified as N1.
The N1 clone presented reduced mitochondrial NNT pro- tein, as observed in subcellular fractionation assays and im- munofluorescence (in green) (Fig. 3D and 3E). These cells showed significantly reduced mitochondrial mass, as observed with the Mitotracker probe (in red; P <. 0001; Fig. 3C and 3E). Additionally, ROS levels were significantly higher in N1 cells (P <. 0001; Fig. 3A).
We also evaluated the effect of NNT knockdown on ad- renal steroidogenesis beyond cortisol secretion. Compared with the control, the deficiency of NNT significantly reduced cortisol and aldosterone secretion (P <. 0001 and P =. 006, re- spectively; Fig. 4A and 4B). According to this observation, NNT-deficient H295R cells exhibited increased mRNA ex- pression of the underlying steroidogenic enzyme or coenzyme genes including STAR (P =. 006), CYP11A1 (P =. 001), and CYP11B1 (P<0.0001) and decreased CYP11B2 expression (P <. 0001) (Fig. 3 (13)). NNT-deficient H295R cells showed cholesterol lipid droplets with decreased size (P =. 009) and density (P =. 03) (Fig. 4C). NNT-deficient H295R cells did not respond to FSK stimulation (Fig. 4D), nor to the antioxi- dant N-acetylcysteine (Fig. 4E).
NNT WT Expression Restorage in NNT-deficient Adrenal Cells Rescues Antioxidant Defense Mechanisms and Partially Recovers Steroidogenic Response
NNT deficiency generated by the CRISPR/Cas9 system in H295R cells caused oxidative stress (Fig. 2F). This effect
A
B
NNT c. 2597 G WT
I
T
À GG CTC G
II
NNT c.2597G>A Heterozygous
T
AGNCTO
c
G
C
NNT c.2597G>A Homozygous
T
AGACTCG
| Species | Amino Acid Sequence | ||
|---|---|---|---|
| H. sapiens | NNLLTIVGALI | G | SSGAILSY |
| P. troglodytes | NNLLTIVGALI | G | SSGAILSY |
| M. mulatta | NNLLTIVGALI | G | SSGAILSY |
| G. gallus | NNLLTIVGALI | G | SSGAILSY |
| C. elegans | NNLLTIVGALI | G | SSGAILSY |
| R. norvegicus | NNLLTIVGALI | G | SSGAILSY |
Figure 1. Molecular investigation. (A) Analysis of chromatograms confirmed segregation of the homozygous p.G866D NNT variant with the phenotype; asymptomatic parents and the younger brother were heterozygous. (B) Family pedigree showing the presence of the p.G866D NNT variant. (C) Conservation of the glycine residue at NNT codon 866 among different species.
probably resulted from reduced NNT function and disrupted antioxidant defense mechanisms. To prove this mechanism, we restored NNT levels by re-expressing HaloTag-NNT WT in these NNT-deficient adrenal cells. NNT re-expression restored ROS levels to control levels (Fig. 4B (13)). Furthermore, in this transient transfection model, HaloTag-NNT WT significantly increased cortisol produc- tion after 144 hours of transfection (Fig. 4C (13)).
Finally, we evaluated whether the p.G866D NNT variant alters antioxidant mechanisms in adrenal cells. NNT-deficient H295R cells were transfected with the WT or p.G866D NNT variant plasmid. Basal cellular ROS levels were significantly higher in homozygous p.G866D NNT ad- renal cells than in WT NNT adrenal cells (P =. 0012). Furthermore, after stimulation of steroidogenesis with FSK, homozygous p.G866D NNT adrenal cells significantly in- creased ROS levels, (P <. 0001; Fig. 4E (13)) and cortisol se- cretion was unaltered (Fig. 4F (13)).
NNT Is Expressed in Human Adrenal Cortex From the Fetal Period to Adult Life
Immunohistochemistry staining revealed that the NNT pro- tein is abundantly expressed in human fetal and adult adrenal cortex. Representative images are shown elsewhere (Fig. 5A and 5B (13)). In the fetal adrenal cortex, NNT staining was stronger in the transition zone between the 18th and 32nd weeks of gestation. In line with our findings, NNT staining was stronger in zona fasciculata in the adult adrenal cortex.
Discussion
We have described the novel p.G866D NNT homozygous mu- tation found in a patient with FGD diagnosed at the age of 18 months and have presented detailed evidence of how this NNT loss-of-function variant in the homozygous state results in FGD. Moreover, by generating an NNT knockdown by CRISPR/Cas9, we have been able to recapitulate, in adrenal cortex cells, the mitochondrial abnormalities observed in mononuclear blood cells of the affected patient. Moreover, we have shown that ROS accumulation in these NNT-deficient adrenal cells deregulates steroidogenic enzyme expression, impairs intracellular cholesterol traffic, and re- duces cortisol and aldosterone production. In addition, we have shown that NNT is expressed in the fetal adrenal cortex and in the entire adult adrenal cortex.
Few NNT mutations have been found in FGD patients since the first description in 2012 (3, 11, 12, 20-22). p.G866D is a rare NNT variant. Until now, this variant has not been de- scribed in any of the available public gene banks. The amino acid glycine at NNT residue 866 is well conserved in different species, which suggests it is important for NNT function. Furthermore, several in silico tools have predicted that the p.G866D variant is deleterious. Pedigree analysis has con- firmed its segregation with the FGD phenotype in the affected patient’s homozygous state, while his first-degree cousin pa- rents and his younger brother have normal adrenal function and no clinical phenotype.
By analyzing mononuclear blood cells from the affected pa- tient and his heterozygous family members, we found that
A
1.5
1.5
B
1.2
1.2
*
**
*
**
DCFDA (MIF)
1.0
1.0-
0.8
0.8
GSH
0.5
0.5-
0.4
0.4-
0.0
0.0
0.0
0.0
WT
G866D
WT
G866D
WT
het. G866D
G866D
WT
het. G866D
G866D
C
D
1.6
1.6
100
100
**
1.2.
1.2
75
75-
ATP
Viability
0.8
0.8
50
50-
0.4-
0.4-
25
25-
0.0
0.0
0
0
WT
G866D
WT
G866D
WT
G866D
WT
G866D
E
Mitotracker
Basal
Hoechst
1.2
Mitotracker (MIF)
0.8
*
0.4
WT
5.00 uM
G866D
5.00 uM
0.0
WT
G866D
Oxidative Stress Induction
1.2
**
0.8.
0.4.
WT
5.00 uM
G866D
5.00 uM
0.0
WT
G866D
Basal
Oxidative Stress Induction
A
B
C
D
2.5-
150
4.0x106
2.0
C-
N1
DCFDA (MIF)
Mitotracker (MIF)
100
3.0×106
1.5-
Viability
Anti NNT
1.0-
2.0×106
(114 kDa)
50
0.5-
1.0×106
Anti VDAC (32 kDa)
0.0
C-
N1
0
C-
N1
0
C-
N1
E
Anti NNT
Mitotracker
Merge
C-
N1
p.G866D NNT in the homozygous state reduces the mito- chondrial mass, increases ROS formation, and reduces GSH levels under basal conditions. Challenging these cells with H2O2, to mimic oxidative stress conditions, reduces mito- chondrial mass and GSH levels with consequent increases in ROS formation. Interestingly, under basal condition, GSH levels remain unaffected in heterozygous carriers, which is consistent with the absence of clinical abnormalities in these apparently healthy carriers. However, when stimulating the
heterozygous p.G866D NNT carriers’ cells with H2O2, sig- nificantly low GSH levels compared with control NNT WT mononuclear blood cells were observed. The importance of this finding in asymptomatic carriers remains to be further ex- plored. Increased oxidative stress has been observed under basal conditions in the fibroblasts of a patient with FDG har- boring the homozygous p.G200S NNT variant (11)
In the oxidative stress defense mechanism, which depends on NNT function, NADPH production is maintained by H+
A
B
0.4
C
30
5
0.3
Cortisol (nmol/L/ug protein)
Aldosterone (nmol/L protein)
0.3
Density Lipid droplets
4
Lipid droplets size
**
20-
**
0.2.
3
0.2-
2
10-
0.1
0.1
1
0
0.0
0
0.0
C-
N1
C-
N1
C-
N1
C-
N1
D
200
E
ns
20
ns
ns
Cortisol (nmol/L/ug protein)
150
Cortisol (nmol/L/ug protein)
15
Vehicle
100
10
FSK
50
5
NAC
0
0
C-
C-
N1
N1
C-
C-
N1
N1
F
C-
N1
Mitotracker
NBD Colesterol
DAPI
0
um
10
0 pm 10
equilibrium ensured by the NNT protein (23). The GSH/ GSSG ratio is maintained by using NADPH as a cofactor, and H2O and O2 are the final products derived from this path- way. This physiological process requires ATP, and is import- ant for preventing cell death (24).
We have also found significantly reduced ATP formation after inducing oxidative stress in NNT p.G866D homozygous mononuclear blood cells, but not under basal conditions. The NNT p.G200S mutation impairs ATP production even under basal conditions (11), probably because the S200 variant is
located within the first NADPH domain, while the D866 variant lies in the transmembrane domain. Together, these results indi- cate that NNT function is more impaired in the S200 than in the D866 variant. These data could explain why deficient aldoster- one secretion is not clinically relevant in our D866 patient. It is well known that cortisol concentration in circulation is nearly 1000-fold higher than aldosterone concentration. Thus, there is the possibility of putative residual activity of this NNT vari- ant, insufficient to prevent hypocortisolism, but enough to allow some aldosterone secretion to prevent salt losing.
A large amount of energy is needed for rehabilitating the antioxidant system and, once ATP formation is impaired, cell death increases. We have not observed differences in cell death among the cells under basal conditions. However, after oxidative stress is induced, we have verified that the number of dead NNT p.G866D homozygous mononuclear blood cells increases by over 50%. This finding agrees with a previous study showing that impaired response to stress conditions causes cell death (25).
The adrenal cortex exhibits high levels of several antioxi- dants. Antioxidant mechanisms are necessary given the high turnover of lipid within mitochondria and high ROS produc- tion during steroidogenesis (9). In our experiments on mono- nuclear blood cells, we attempted to mimic the oxidative stress environment by adding hydrogen peroxide. Our data suggest that, in adrenal glands of patients with FGD harboring the NNT mutation, the adrenal cortex undergoes rapid changes after birth, which results in fetal adrenal cortex involution and progressively increased demand for adrenal steroids. In this scenario, cells exhibiting an antioxidant defense system with reduced capacity due to impaired NNT function would cope less efficiently under higher stress conditions and eventu- ally die. This hypothesis could explain why adrenal insuffi- ciency is not present since birth.
Little is known about the NNT expression pattern during adrenal development and in the human adult adrenal cortex zones. Prenatal adrenals consist of an inner layer, the fetal zone, and a newly emerging outer layer, the definitive zone. After midgestation, a third layer, the transition zone, derived from the definitive zone, appears between these 2 zones. This zone begins to synthesize cortisol during the third trimester and will originate the adult fasciculata zone. In line with the phenotype of FGD patients, in whom cortisol deficiency is al- ways severe, we have found stronger NNT staining in the fetal transition zone and adult zona fasciculata (26).
For practical and ethical reasons, the few functional studies evaluating NNT mutants published to date have not used ad- renal cells from the affected patients. To explore the import- ance of NNT in adrenal physiology in detail, in this study we have generated NNT-deficient H295R adrenocortical car- cinoma cells by using the CRISPR/Cas9 technology. Our deci- sion to knock down NNT by using CRISPR/Cas9 gene-editing aimed to generate a more stable model given that RNA inter- ference protocols result in a transient model, making them re- semble the potential effects of germline loss-of-function mutations to a lesser extent.
Steroidogenesis significantly contributes to mitochondrial ROS production; in turn, oxidative stress can impair steroido- genesis (9). Our data have demonstrated that, as in the case of mononuclear blood cells, NNT function loss in adrenal cor- tical cells impairs the mitochondrial antioxidant defense sys- tem, increasing ROS production and reducing the stained mitochondria. This finding is consistent with data found after siRNA NNT in H295R cells (3). Besides that, when NNT ex- pression is restored in this knockdown model, antioxidant de- fense mechanisms are restored. As in the case of mononuclear blood cells, adrenal cells with the p.G866D variant accumu- late ROS, confirming that mutations in NNT compromise antioxidant defense mechanisms and induce oxidative stress in adrenal cells.
All steroidogenic cells have similar fundamental steroido- genesis structures, especially in the early stages. Mitochondria play a central role in steroidogenesis. Steroid
hormone biosynthesis begins with cholesterol transport into mitochondria, which are cleaved by the action of cytochrome P450scc, located in the inner mitochondrial membrane (27). We have shown that NNT is important for cholesterol traf- ficking in adrenal cells. NNT deficiency results in reduced cholesterol droplet size and cholesterol efflux. These data are consistent with clinical observations of no lipid accumula- tion in the adrenal from patients with NNT mutation.
P450 enzymes in mitochondria include P450scc (CYP11A1), which catalyzes cholesterol conversion to pre- gnenolone, and P450c11b (CYP11B1), which underlies 11-deoxycortisol beta-hydroxylation to cortisol. These reac- tions require NADPH as a reducing agent, and these enzymes receive electrons from NADPH via the flavoprotein ferredoxin reductase and the small iron-sulfur protein ferredoxin (28). Our results have shown that NNT loss impacts the expression of key steroidogenic enzyme genes, including those involved in steroidogenesis mitochondrial steps, such as CYP11A1 and CYP11B1.
In line with the aforementioned results, cortisol and aldos- terone production decreases significantly in NNT-deficient H295R adrenal cells. Significantly impaired aldosterone pro- duction in our model is not in line with the clinical phenotype observed in our patient and most FGD patients described to date (11, 12, 21). However, slightly low plasma sodium and slightly increased renin activity were observed in our patient. Most of the affected patients do not present clinically relevant aldosterone deficiency. One possibility is that the complete ab- sence of NNT, as in the case of our model, is the reason for al- dosterone impairment. On the other hand, in the case of most point mutations, which are described in most patients, aldos- terone production would be maintained. This hypothesis needs to be tested in further studies. Another potential explan- ation is the existence of a compensatory redox mechanism in the zona glomerulosa, which can compensate for the absence of normal NNT function.
We have shown that NNT re-expression in NNT-deficient H295R adrenal cells partially restores the steroidogenic re- sponse. This finding reassures that NNT is required in steroi- dogenesis. In our transient transfection model, NNT re-expression significantly increases cortisol production 144 hours after transfection, suggesting that a longer transfec- tion time would restore integral steroidogenesis.
In conclusion, we have demonstrated that NNT is ex- pressed in fetal and adult adrenal cortex and is essential for mitochondrial activity in adrenal cells. We identified a Brazilian boy with FGD due to a novel pathogenic NNT vari- ant, p.G866D NNT. CRISPR/Cas9 NNT knockdown recapit- ulates the FGD phenotype in adrenal cells as shown by decreased mitochondrial mass/activity and increased ROS lev- els and cell death, impaired cholesterol trafficking, and re- duced cortisol and aldosterone production, confirming that NNT is essential for optimal steroidogenesis.
Acknowledgments
We thank Professor Claudimara Lotfi (Institute of Biomedical Sciences, University of Sao Paulo, ICB/USP) for providing the H295R adrenal cell lines and Professor Agnaldo Luis Simões (Laboratory of Biochemical Genetics, Department of Genetics, FMRP-USP) for performing cell line authentication. We thank Deisy Mara da Silva (Laboratory of Pathology and Forensic Medicine, FMRP-USP), Jose Roberto Silva,
(Laboratory of Endocrinology-Neuroendocrinology, FMRP-USP), Professor Dr. Vânia Luiza Deperon Bonato and Denise Brufato Ferraz (Flow Citometry Laboratory, Department of Biochemistry and Immunology, FMRP-USP), and Professor Dr. Munira Muhammad Abdel Baqui and Elizabete Rosa Milani (Confocal Microscopy Multiuser Laboratory, FMRP-USP) for their competent technical support.
Financial Support
This work was funded by the Coordination for the Improvement of Higher Education Personnel (CAPES) and National Council for Scientific and Technological Development (CNPq) (AFB), and by the Sao Paulo State Research Foundation (FAPESP) grant 14/03989-6 (SRA and MC).
Disclosure
The authors have nothing to disclose.
Data Availability
Some or all datasets generated during and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request.
References
1. Chan LF, Clark AJL, Metherell LA. Familial glucocorticoid defi- ciency: advances in the molecular understanding of ACTH action. Horm Res Paediatrics. 2008;69(2):75-82.
2. Meimaridou E, Hughes CR, Kowalczyk J, et al. Familial gluco- corticoid deficiency: new genes and mechanisms. Mol Cell Endocrinol. 2013;371(1-2):195-200.
3. Meimaridou E, Kowalczyk J, Guasti L, et al. Mutations in NNT en- coding nicotinamide nucleotide transhydrogenase cause familial glucocorticoid deficiency. Nat Genet. 2012;44(7):740-742.
4. Buonocore F, Maharaj A, Qamar Y, et al. Genetic analysis of pedi- atric primary adrenal insufficiency of unknown etiology: 25 years’ experience in the UK. J Endocr Soc. 2021;5(8):bvab086.
5. Flück CE. MECHANISMS IN ENDOCRINOLOGY: update on pathogenesis of primary adrenal insufficiency: beyond steroid en- zyme deficiency and autoimmune adrenal destruction. Eur J Endocrinol. 2017;177(3):R99-R111.
6. Hoek JB, Rydström J. Physiological roles of nicotinamide nucleo- tide transhydrogenase. Biochemical J. 1988;254(1):1-10.
7. Haddad JJ. Antioxidant and prooxidant mechanisms in the regula- tion of redox(y)-sensitive transcription factors. Cell Signal. 2002;14(11):879-897.
8. Miller WL, Auchus RJ. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr Rev. 2011;32(1):81-151.
9. Prasad R, Kowalczyk JC, Meimaridou E, Storr HL, Metherell LA. Oxidative stress and adrenocortical insufficiency. J Endocrinol. 2014;221(3):R63-R73.
10. Picard M, McManus MJ, Gray JD, et al. Mitochondrial functions modulate neuroendocrine, metabolic, inflammatory, and transcrip- tional responses to acute psychological stress. Proc Natl Acad Sci U S A. 2015;112(48):E6614-E6623.
11. Weinberg-Shukron A, Abu-Libdeh A, Zhadeh F, et al. Combined mineralocorticoid and glucocorticoid deficiency is caused by a nov- el founder nicotinamide nucleotide transhydrogenase mutation that alters mitochondrial morphology and increases oxidative stress. J Med Genet. 2015;52(9):636-641.
12. Fujisawa Y, Napoli E, Wong S, et al. Impact of a novel homozygous mutation in nicotinamide nucleotide transhydrogenase on mito- chondrial DNA integrity in a case of familial glucocorticoid defi- ciency. BBA Clin. 2015;3(3):70-78.
13. Faccioli Bodoni A, Coeli-Lacchini F, Gebenlian JL, et al. Supplementary data Bodoni AF.docx. Figshare. Deposited November 19, 2022. https://doi.org/10.6084/m9.figshare.21586716.v1
14. Gomes DC, Leal LF, Mermejo LM, et al. Sonic hedgehog signaling is active in human adrenal cortex development and deregulated in adrenocortical tumors. J Clin Endocrinol Metab. 2014;99(7): E1209-E1216.
15. Leal LF, Bueno AC, Gomes DC, Abduch R, de Castro M, Antonini SR. Inhibition of the Tcf/beta-catenin complex increases apoptosis and impairs adrenocortical tumor cell proliferation and adrenal steroidogenesis. Oncotarget. 2015;6(40):43016-43032.
16. Sobral LM, Sousa LO, Coletta RD, et al. Stable SET knockdown in head and neck squamous cell carcinoma promotes cell invasion and the mesenchymal-like phenotype in vitro, as well as necrosis, cis- platin sensitivity and lymph node metastasis in xenograft tumor models. Mol Cancer. 2014;13(1):32.
17. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2- 44CT method. Methods. 2001;25(4):402-408.
18. Sobral LM, Coletta RD, Alberici LC, Curti C, Leopoldino AM. SET/I2PP2A overexpression induces phenotypic, molecular, and metabolic alterations in an oral keratinocyte cell line. FEBS J. 2017;284(17):2774-2785.
19. Moreira AC, Elias LL. Pituitary-adrenal responses to corticotropin- releasing hormone in different degrees of adrenal 21-hydroxylase deficiency. J Clin Endocrinol Metab. 1992;74(1):198-203.
20. Yamaguchi R, Kato F, Hasegawa T, et al. A novel homozygous mu- tation of the nicotinamide nucleotide transhydrogenase gene in a Japanese patient with familial glucocorticoid deficiency. Endocr J. 2013;60(7):855-859.
21. Roucher-Boulez F, Mallet-Motak D, Samara-Boustani D, et al. NNT Mutations: a cause of primary adrenal insufficiency, oxida- tive stress and extra-adrenal defects. Eur J Endocrinol. 2016;175(1):73-84.
22. Jazayeri O, Liu X, van Diemen CC, et al. A novel homozygous in- sertion and review of published mutations in the NNT gene causing familial glucocorticoid deficiency (FGD). Eur J Med Genet. 2015;58(12):642-649.
23. Kampjut D, Sazanov LA. Structure and mechanism of mitochon- drial proton-translocating transhydrogenase. Nature. 2019; 573(7773):291-295.
24. Haddad JJ. Oxygen sensing and oxidant/redox-related pathways. Biochem Biophys Res Commun. 2004;316(4):969-977.
25. Prasad R, Chan LF, Hughes CR, et al. Thioredoxin reductase 2 (TXNRD2) mutation associated with familial glucocorticoid defi- ciency (FGD). J Clin Endocrinol Metab. 2014;99(8):E1556-E1563.
26. Kovacs CS, Deal C. Maternal-fetal and Neonatal Endocrinology: Physiology, Pathophysiology, and Clinical Management. Academic Press; 2019.
27. Miller WL, Bose HS. Early steps in steroidogenesis: intracellular cholesterol trafficking. J Lipid Res. 2011;52(12):2111-2135.
28. Miller WL. Steroid hormone synthesis in mitochondria. Mol Cell Endocrinol. 2013;379(1-2):62-73.