@ ELSEVIER
Gene
journal homepage: www.elsevier.com/locate/gene
GENE
Objective assessment of adrenocortical carcinoma driver genes and their correlation with tumor pyruvate kinase M2
Check for updates
Rudradip Das, Moumita Ghosh Chowdhury, Sonal Raundal, Jyotika Jadhav, Navin Kumar, Sagarkumar Patel, Amit Shard
Department of Medicinal Chemistry, National Institute of Pharmaceutical Education and Research- Ahmedabad, Gandhinagar, Gujarat 380054, India
| ARTICLE INFO | ABSTRACT |
|---|---|
| Edited by: John Doe | Glandular cancers have a significant share of the total cancer patients all over the world. In the case of adre- nocortical carcinomas (ACCs), although the benign form is more frequent and common, the malignant form provides a very less percentage of patients with five or more than five years of survival rate. There are gene alterations that are involved as a crucial factor behind the occurrence of ACCs. Out of these, the most prominent genetic alterations (PRKAR-1A, CTNNB1, ZNRF3, TP53, CCNE1 and TERF2 genes) are linked with a glycolytic enzyme pyruvate kinase M2 (PKM2), which converts phosphoenolpyruvate (PEP) to pyruvate in the glycolytic pathway. The involvementof PKM2 renders a cumulative effect through different pathways that may result in the onset of ACCs. Thus, this review aims to establish a link between ACCs, alterations of specific genes and PKM2. |
| Keywords: Gene alteration Glycolysis B-catenin Warburg effect Oxidative phosphorylation |
1. Introduction
Unearthing the physiological underpinnings of adrenocortical car- cinomas (ACCs) has been a daunting task. As the name suggests, ACCs have their origin in the adrenal glands and represent aggressive tumor types. The heterogeneous outcome is observed in these cancers even if the prognosis is poor. The symptoms include the formation of lumps, pain, and fullness in the abdomen (Crona and Beuschlein, 2019). ACCs are different from the ones that occur in the adrenal cortex (cortical adenoma), which are quite common with an occurrence rate of more than 10% (Torti and Adrenal, 2021). On the contrary, the ACCs have only 0.7 to 2 cases per million of the total population and have an average survival rate of 5 years in less than 35% of the diagnosed cases (Libé, 2015). Other tumors and cancers that invade the adrenal glands include pheochromocytoma, myelolipoma, adrenal cyst, neuronal tumor, metastases, and adrenocortical adenoma (Assié et al., 2014).
ACCs are known to be associated with ancestral tumor signs and symptoms, which consist of multiple endocrine neoplasia type 1 (MEN- 1; MEN1 tumor suppressor mutation at 11q13), Li-Fraumeni syndrome (mutation on 17p13 of p53), Beckwith-Wiedemann syndrome (gene cluster mutations on 11p15.5 and 15q11-13), and Carney complex (mutation of PRKAR1A gene at 17q23-24 or mutations at 2p16) (Kjellman et al., 1999; Libé, 2015). There are mainly four stages of ACCs with varying percentages of five-year survival rates (Else et al., 2014). The worst cases of ACCs are those that have cortisone hypersecretion as a part of their prognosis (Assié et al., 2014; Calissendorff et al., 2016). Although there are some treatments like the adrenolytic drug mitotane and cytotoxic chemotherapy available at disposal, they have also shown very limited therapeutic potential against these aggressive cancers that leave invasive surgery as the only alternative with a bleak success rate (as low as 15%) (Schiavone et al. 2019; Luton et al., 1990). Either laparoscopic or open adrenalectomy is performed after measuring the
Abbreviations: ACC, Adrenocortical Carcinoma; MEN-1, Multiple Endocrine Neoplasia type 1; MIB,1, MIB E3 Ubiquitin Protein Ligase 1; PEP, Phosphoenolpyr- uvate; ADP, Adenosine diphosphate; ATP, Adenosine triphosphate; PKM2, Pyruvate Kinase M2; SNP, Single Nucleotide Polymorphism; CDKN2A, Cyclin,Dependent Kinase Inhibitor 2A; DAXX, Death Domain,Associated Protein 6; MED 12, Mediator Complex Subunit 12; ZNRF3, Zinc and Ring Finger 3; PRKAR,1A, Protein Kinase cAMP,dependent type I Regulatory Subunit Alpha; CTNNB1, Catenin Beta,1; P53, Tumor protein; CCNE1, Cyclin E1; TERF2, Telomeric repeat,binding factor 2; GEPIA, Gene Expression Profiling Interactive Analysis; MDM2, Murine double minute 2 ; CCDN1, Cyclin D1; STAT3, Signal transducer and activator of transcription 3; CDK2, Cyclin,dependent kinase 2; RB1, Retinoblastoma protein; P21Cip1, Cyclin,dependent kinase inhibitor 1; pRb, Retinoblastoma PRotein; hTERT, Telomerase Reverse Transcriptase; SV40, Simian Vocuolating virus 40; H,Ras, Harvey Rat Sarcoma Virus also known as transforming protein p21; Akt, Protein kinase B (Serine/ threonine,specific protein kinases.
* Corresponding author. Tel. : +91 79 66745555, +91 79 66745501; fax: +91 79 66745560. E-mail address: amit@niperahm.res.in (A. Shard).
https://doi.org/10.1016/j.gene.2022.146354
suitability of individual cases (Sahbaz et al., 2020). Ki-67/MIB1 (Ki-67 (antibody clone MIB-1) is a protein of nuclear origin that is significant in cell proliferation maintenance and is found in all non-G0 cell cycle phases. Labelling indexes like the Ki-67/MIB1, evolved as a handy his- tological grading system to grade ACCs and the duration of tumor-free survival and nowadays has become a proficient component of patho- logical reports in the case of patients diagnosed with ACCs. The signs and symptoms of hormonal disorders should be carefully examined in all individuals with suspected ACCs (Veytsman et al., 2009). Gaining weight, muscle atrophy, purple lines on the belly, a fatty “buffalo hump” on the neck, a “moon-like” face, and thinning, brittle skin are all symptoms of Cushing’s syndrome (glucocorticoid excess) (Veytsman et al., 2009). Excess facial and body hair, acne, clitoris enlargement, voice deepening, coarsening of facial features, and menstruation halts are all symptoms of virilism (androgen excess) in women (Komiya et al., 1979). Increased blood pressure, which can cause headaches and hypokalaemia (low level of serum potassium, which can cause muscular weakness, disorientation, and palpitations), low plasma renin activity, and high serum aldosterone are all symptoms of Conn syndrome (mineralocorticoid excess) (Veytsman et al., 2009). Breast enlargement, reduced libido, and impotence are the most common symptoms of femininization (excess oestrogen) (Veytsman et al., 2009).Here it is pertinent to mention that once the hormonal imbalance onsets, it may lead to chronic diseased conditions. These hormonal disorders have the propensity to lead to adrenocortical carcinomas due to cortical hyper- secretion (McNicol, 2008; Komiya et al., 1979; Crawford and Harris, 2012). Therefore, it is crucial to unwind the genetic alterations that are the underlying cause of these cancers. The genomic mapping and its understanding is a stepping stone to discover the root cause of ACCs (Bedrose et al., 2020). There are specific genes whose involvement and the protein they code for, play a pivotal role in the onset of ACCs (Assié et al., 2014). Among them, the pyruvate kinase M (PKM) gene stands out as one of the genes that can be accounted responsible based on the evidential fact from the gene expression profiling interactive analysis (GEPIA 2021) (Yan et al., 2021). The PKM gene encodes a glycolytic protein. The human PKM gene is 32,315 kb long and consists of 11 in- trons 12 exons. The homology between human PKM1 and human PKM2 is 96%. Type M1 and type M2 pyruvate kinase isoenzymes are splicing products of the PKM gene (exon 9 for PKM1 and exon 10 for PKM2). Both mRNAs include 1593 base pairs and differ by 160 nucleotide res- idues between 1143 and 1303. PKM1 is expressed in tissues that require high quantities of energy on a regular basis, such as skeletal muscle, the heart, and the brain. There are various domains that collectively make up the 531 amino acids (aa) of a monomer. The N-domain (aa 1-43), the A-domain (aa 44-116 and 219-389), the B-domain (aa 117-218), and the C-domain (aa 117-218) are the four domains that make up each monomer of PKM2 (aa 390-531). The C domain contains 44 amino acids of a 56-amino-acid stretch (aa 378-434) that differs between PKM1 and PKM2 isoenzymes and is responsible for PKM1 and PKM2’s varied ki- netic properties and regulation mechanisms, such as fructose 1,6- bisphosphate activation and interaction with different oncoproteins. The active site of the enzyme is located in the cleft produced between the A- and B-domains. An inducible nuclear translocation signal is found in the C-domain (aa 393-531). The PKM2 monomer has a molecular weight of 58 kD. Unlike the other PK isoenzymes, which have a tetra- meric quaternary structure, PKM2 can be found in both tetrameric and dimeric forms. The intracellular interaction between the A-domains of two monomers results in the dimeric form of PKM2. PKM2 is the major PK in proliferating and malignant cells, except for mature muscle, brain, and liver. PKM1 forms tetramer (a stable form of pyruvate kinase) while PKM2 exists in both dimer and tetramer forms. The dimer of PKM2 has a lower Km (Michaelis constant) for PEP than the tetramer, making it less active in converting PEP to ATP and pyruvate. While tetrameric PKM2 promotes ATP synthesis via the TCA cycle, dimeric PKM2 is important for aerobic glycolysis (Puckett et al., 2021; Wong et al., 2013). This is a kinase (pyruvate kinase) protein that presides over a phosphoryl group
transfer from phosphoenolpyruvate (PEP) to ADP, furnishing ATP and pyruvate in the process. This protein interacts with thyroid hormones and is known to facilitate thyroid hormone-induced cellular metabolic effects (Rihan et al., 2019; Patel et al., 2021). Reports support quite a few alternatively spliced transcript variants encoding a few distinct isoforms (Zhang et al., 2019). The involvement of PKM gene’s alter- ations are well versed as overexpression of one of the isoforms of PKM known as the tumor pyruvate kinase M2 (PKM2) in the dimeric form (in normal condition, PKM2 is in tetrameric form) clears the pathway for Warburg effect. This aids in the formation of lactate instead of pyruvate even in aerobic conditions and ultimately results in tumors proliferating themselves onto cancers (Zhang et al., 2019). Exome sequencing and SNP array analysis have revealed variations at a single site in DNA, which is the most frequent type of genomic variation that leads to the confirmation of the involvement of genes such as CTNNB1, TP53, CDKN2A, RB1 and MEN1 and in genes not previously reported in ACC (ZNRF3, DAXX, TERT and MED12). Drastic changes in the copy number, DNA methylation and microRNA (miRNA) expression are the key factors that lead to the alterations in driver genes initiating the whole cascade of events that conclusively form proliferating metastatic malignant tumors evolving into ACCs (Armignacco et al., 2018). There are three major pathways, which once distorted can trigger the onset of ACCs. These include the ß-catenin pathway (involving ZNFR3 and CTNNB1 genes), the p53/Rb signalling pathway (involving TP53 gene), the chromatin remodelling pathway, and the cAMP/PKA signalling pathway (involving PRKAR1A gene). These pathways encompass almost all the driver genes associated with this fiasco (Assié et al., 2014). Although there is ample literature available for rarest ACCs in general and specific genetic al- terations as well, there isalacunae in the area that has been unravelled recently directly linking the overexpression of PKM2 causing genetic alterations in driver genes such as PRKAR-1A, CTNNB1, ZNRF3, TP53, CCNE1, and TERF2 genes in particular (Zheng et al., 2016). Through this review, we aim to establish a detailed relation between PKM2 over- expression and alteration of the driver genes that direct initiation and progression of ACCs.
2. Driver gene ZNRF3 alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
Out of the several genes responsible for the progression of ACC, Zinc and RING finger 3 (ZNRF3) gene is a significant protein-coding gene and its homology is RING finger 43 (RNF43). It is a member of the trans- membrane E3 ubiquitin ligase family. It has a single peptide, extracel- lular domain, and intracellular RING domain (Hao et al., 2016). ZNRF3 is the most frequently altered gene (about 21%) in ACC (Assié et al., 2014). ZNRF3 gene is present in the cell membrane with Wnt receptor frizzled (FZD) and low-density lipoprotein (LRP5/6) co-receptor (Basham et al., 2019). ZNRF3 also promotes the ubiquitination of the Wnt receptor frizzled (FZD) and LRP6 co-receptor. The ZNRF3 gene controls the Wnt/ß-catenin signalling pathway. Wnt/ß-catenin signal- ling pathway mainly regulates cell proliferation and differentiation in ACC. The pathway mainly consists of a Wnt ligand, receptors such as Frizzled (FZD), and a low-density lipoprotein (LRP5/6) co-receptor with the ZNRF3 gene (Mo et al., 2019). The ZNRF3 gene has a major role in inhibiting the Wnt/ß-catenin signalling pathway in ACC. Once dishev- elled (DVL) protein binds to the ZNRF3 gene (as shown in Fig. 1), the latter promotes degradation of FZD and its co-receptor LRP5/6. This in turn prevents complex formation between FZD and its co-receptor LRP5/6.
Physical interaction of ZNRF3 with dishevelled (DVL) is necessary for its function. Generally,
DVL acts as an adapter protein that targets ZNRF3 to FZD (Bonnet- Serrano and Bertherat, 2018). When the Wnt ligand is absent in the pathway then the destruction complex of Axin-GSK36-APC and CK1x phosphorylates ß-catenin. Then the ß-catenin is degraded by the pro- teasome pathway. This inhibits entry of ß-catenin to the nucleus and
ZNRF3
FZD
LGR4/5
LRP5/6
DVL
Ub
Ub
Ub
Ub
CKla
GSK-3฿
ß-Catenin
P
Axin
APC
Proteasome mediated degradation
Groucho
TCF/LEF
interaction with TCF/LEF.Henceforth Groucho forms a complex with TCF/LEF (Fig. 1). This cascade of events occurs as ZNRF3 inactivates the Wnt/ß-catenin signalling pathway in ACC. As a consequence, there is a reduction of cell proliferation and differentiation of the diseased cells. This should also be mentioned that ZNRF3 gene is the negative feedback control of the Wnt/ß-catenin signalling pathway and acts as a tumor suppressor in ACC.
Tumor cells need to overcome this for survival, it can be achieved through mutation of the ZNRF3 gene and upregulation of R-spondin. Due to the mutation of the ZNRF3 gene, it is not able to block the Wnt- Signalling pathway in ACC (Fig. 2). LGR4/5 are members of leucine-rich G-protein coupled receptors that have a high affinity towards R-spondin. When R-spondin binds to the LGR4/5 receptor, it induces the
degradation and ubiquitination of the ZNRF3 protein. In this way, R- spondin is a natural antagonist of the ZNRF3 protein. Hence, upregu- lation and translocation of R-spondin antagonize the action of the ZNRF3 gene. As a result, the ZNRF3 gene becomes inactive and the Wnt/ B-catenin signalling pathway occurs in ACC (Fig. 2) (Hao et al., 2016). The Wnt/ß-catenin signalling pathway takes place when the Wnt ligand is present and it binds to the FZD receptor with low-density lipoprotein (LRP5/6) coreceptor. Then dishevelled (DVL) protein is activated, which inhibits the destruction complex consisting of Axin-GSK3B-APC-CSK1x and stabilizes the ß-catenin in the cytoplasm. Therefore, the accumula- tion of ß-catenin in the cytoplasm increases and enters into the nucleus. In the nucleus, the Groucho will release as the direct contact of lymphoid enhancer factor/T-cell factor (LEF/TCF) with ß-catenin (Martin-Orozco
ZNRF3
R-Spondin
Wnt
Glucose
LRP
FZD
LGR5
Glucose
DVL
Glycolysis
Glucose-6-Phosphate
GSK-3ß
CKla
Axin
APC
ß-Catenin
ß-Catenin
Phosphoenolpyurvate
ß-Catenin
ADP
PKM2 Dimer
PKM2
ATP
Pyurvate
Lactate
ß-Catenin
PKM2
TCF/LEF
PDK
MCT
Acetyl Co A
ACC
c-Myc
GLUT1
Gene Expression
TCF4
ß-Catenin
ZnRF3
et al., 2019; Bonnet-Serrano and Bertherat, 2018). The complex of LEF/ TCF with ß-catenin activate transcription of oncoprotein gene such as c- Myc, PDK, GLUT1. The Wnt signalling pathway also controls the expression of rate-limiting enzymes of the metabolic pathway such as PKM2. When transcription factor such as -catenin binds to a specific gene sequence (CACGTG) that leads to overexpression of c-Myc (Mo et al., 2019). Oncoprotein c-Myc upregulates the expression of PKM2 in the cancer cell (Wong et al., 2013).
ZNRF3 smartly orchestrates inhibition of the expression of a variety of genes such as c-Myc, PKM2, and GLUT1, which undergo transcription due to the active Wnt/B-catenin signalling pathway. This prevents the proliferation of cells in ACC. However, if there is inactivation and mu- tation of the ZNRF3 gene, it can cause ACC.
3. Driver gene PRKAR-1A alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
The tumor suppressor gene PRKAR1A is also one of the most mutated genes in ACC (Bossis and Stratakis, 2004). This tumor suppressor gene and oncogene are mostly regulated by PKM2 since it is largely found in tumor cells (Bertherat, 2012). In ACC, inactivated mutation of PRKAR1A activates different pathways such as the MAPK/ERK and glycolytic pathway (Korpaisarn et al., 2017; Yang et al., 2012). PRKAR1A is a regulatory 1« subunit of cAMP-dependent protein kinase (Bossis and Stratakis, 2004; Korpaisarn et al., 2017). The halo-enzyme protein ki- nase A (PKA)is composed of two regulatory subunits (R) and two cata- lytic subunits (C). Initially, PKA halo-enzymes are present in tetrameric form (R2C2), further in the presence of cAMP it is converted into dimeric form and two catalytic subunits are separated. In normal cells, the GPCR pathway activates cAMP which releases the catalytic subunit of PKA. Catalytic subunit phosphorylates into the nucleus and transcribes DNA to RNA and followed by translation into proteins (Bossis and Stratakis, 2004). But in PRKAR1A mutated cells, there is an imbalance between
PKA1 and PKA2 defective type 1. PKA iso-enzyme is responsible for the increasing number of catalytic subunits and finally increases DNA transcription (Korpaisarn et al., 2017; Basso et al., 2014). Skin pigmentation, endocrine over-activity as well as Carney complex (CNC) formation are mostly caused by PRKAR1A gene mutation (Bossis and Stratakis, 2004). Development of ACC is initiated by inactivated muta- tion of the PRKAR1A gene (Bertherat, 2012). Several studies report that there is no direct connection between PRKAR1A mutation and ACCs. However, some diseases in this family like primary pigmented nodular adrenocortical carcinoma (PPNAD) contribute to the development of ACC (Anselmo et al., 2012). Another leading cause of ACC is altered glucose metabolism, investigation of the immunohistochemical analysis demonstrates the involvement of key proteins which cover the metabolic enzymes like PKM2, PKM1, and hexokinase1 (HK1). From these three metabolic biomarkers,it can be deciphered that PKM2 expresses more in ACCs (Duan et al., 2020).
In ACC cell, inactivated mutation of PRKAR1A gene dysregulate various protein kinases, PKM2 is one of them that act as protein kinase into the nucleus. Therefore PRKAR1A might interfere with the protein kinase function of PKM2 (Korpaisarn et al., 2017; Zhang et al., 2019). The PKM2 is activated by PRKAR1A gene through the MAPK/ERK pathway (Else et al., 2014). In ACC, translocation of PKM2 into the nucleus is mostly initiated by epidermal growth factors and also by PRKAR1A mutation through extracellular-signal-regulated kinase (ERK), and then PKM2 accumulates into the nucleus. When PRKAR1A activates MAPK signalling pathway, MAP kinase increases into the cytosol of the adrenal cortex which further stimulates the extracellular- signal-regulated kinase (ERK) (Korpaisarn et al., 2017; Yang et al., 2012) (Fig. 3). EGFR activated ERK binds to the particular amino acids of PKM2 like Ile429 and Leu431, which selectively phosphorylates PKM2 at Ser37 sparing PKM1. Phosphorylated PKM2 at Ser37 enrols the PIN1 to cis-trans isomerization of PKM2. PIN1 is a peptidyl-proline isomerase that further promotes conformational changes into PKM2 which
ACTH-CAMP/PKA Pathway
₿
Ga
+Adenyl cyclase
Y
CAMP
CAMP
R1
C1
R2
C2
C2
C2
C1
PKA 1
C1
C1
C1
Activate other pathways
1 R2IR2 C1
PRKAR1A Mutation
Adrenocortical cell
C1
R1
C1
PKA1
Abnormal DNA transcription increased
MAPK
tumorigenesis
-
n
xxx
converts tetrameric form to monomeric form of PKM2. This exposes the PKM2 nuclear localization signal (NLS) to the binding site of importin 5x. The exon 10 of PKM2 encodes the NLS and facilitates the entry of PKM2 into the nucleus of the adrenocortical cell,where it acts as a transcriptional coactivator (Chen et al., 2020). Further by co-activation of ß-catenin, promotes the c-Myc expression. c-Myc further induces
expression of glucose transporter-1 (GLUT1) and increases glucose up- take, also upregulates lactate dehydrogenase A (LDHA), and increases lactate production. Also activate the CCND1 promoter gene by ß-catenin and PKM2 complex which further phosphorylates histone protein. The Warburg effect is promoted into the nucleus, featuring high lactate production by the higher rate of glucose metabolism that may lead to
PRKAR1A Inactivated Mutation
Activate
SLC2A1 LDHA PDK1
MAPK Pathway
HIF-1
HK1 VEGFA
PKM2 Dimer
Histone h3 phosphorylation
ERK 1/2
Phosphorylation
CCND1
Ser-37
Cell proliferartion & Activation of GLUT1 LDHA
Binding
PKM2 Dimer
PKM2
PKM2 Dimer
Importin 5a
ß Catenin
Tumor cell Glycolysis
C-MYC
PKM2 gene transcription
Adrenocortical cell
Warburg effect
adrenocortical carcinoma onset and enhancement (Korpaisarn et al., 2017; Yang et al., 2012). PKM2 acetylation at Lys433 suppresses the binding of PKM2 to the FBP which enhances nuclear translocation as well as protein kinase activity (Chen et al., 2020). Inside the nucleus gene transcription is increased by protein kinase activity of PKM2, mainly phosphorylates histone protein, transcription factors, and other signalling pathways as well. c-Myc upregulates the expression of the GLUT1, PKM2, and LDHA. Nuclear translocated PKM2 also upregulates the glycolytic proteins and expedite the Warburg effect and tumori- genesis and finally carcinoma inside the adrenocortical cell. Inactivated mutation of PRKAR1A can accelerate adrenocortical carcinoma via activation of MAPK/ERK pathway and PKM2 pathways (Fig. 4) (Chen et al., 2020).
4. Driver gene CTNNB1 alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
CTNNB1 is a gene encoding protein, located in the 3p22.1 region of ß-catenin and has 16 exons (Maharjan et al., 2018). CTNNB1 specifically encodes ß-catenin, which is a 92-kDa protein. ß-catenin is mostly found at cell adhesions and cell junctions and is also involved in the Wnt sig- nalling pathway. CTNNB1 gene mutation at exon 3 is found in most of the tumors which indicate that the mutation of the ß-catenin gene i.e. CTNNB1 contributes to the tumorigenesis (Maharjan et al., 2018; Gao et al., 2018). The core of ß-catenin protein mainly consists of three characteristic domains. The most conserved region is the central region which provides attachment of different proteins such as auxin, the tumor suppressor adenomatous polyposis (APC), DNA bound T cell factor/ lymphoid enhancer factor (TCF/LEF) family of proteins, etc. The serine/ threonine residue of the N-terminal domain serves phosphorylation sites for glycogen synthase kinase (GSK-36) and casein kinase1 (CK-1) recognized by ß-TrCP, an E3 ubiquitin ligase subunit (Fig. 5). The Wnt signalling pathway is activated by mutation of the CTNNB1 gene which causes loss of serine/ threonine residue (Gao et al., 2018; Zhang et al., 2018). Up to 30.8% somatic mutation of CTNNB1 is found in adreno- cortical carcinoma (Durand et al., 2011).
In Wnt/ßcatenin signalling pathway, the Wnt ligand activates DVL protein by binding to the frizzled receptor. The Axin-GSK-36-APC complex is already present in the cytoplasm, which destructs the ß-cat- enin, but activated DVL protein protects the ß-catenin from this destruction complex and increases its accumulation into the cytoplasm. Further, this cytoplasmic ß-catenin enters into the nucleus and binds to TCF/LEF. It leads to transcription of various genes such as c-Myc including PKM2. The expressed PKM2 in dimeric form is involved in the glycolytic pathway where it converts pyruvate into lactate i.e., the Warburg effect (Durand et al., 2011; Martin-Orozco et al., 2019) which
finally leads to tumorigenesis.
CTNNB1 gene (ß-catenin) is also activated by the EGFR pathway. Extracellular ligands like epidermal growth factors activate the epidermal growth factor receptors (EGFR). The EGFR mediates activa- tion of extracellular-signal-regulated kinase (ERK). ERK further, phos- phorylate PKM2 at ser37 residue. PKM2 exposes nuclear localization signal (NLS) to the importin-5x binding site of the nucleus. The exon 10 of PKM2 encodes the NLS and facilitates the entry of PKM2 into the nucleus of the adrenocortical cell. where it acts as a transcriptional coactivator as well as promotes the Warburg effect featuring high lactate production by the higher rate of glucose metabolism leading to enhanced adrenocortical carcinoma (Korpaisarn et al., 2017) (Fig. 6).
5. Driver gene TP53 alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
Most of the ACC instances are sporadic. TP53 germline mutations are responsible for around 70%-80% cases of ACCs, while somatic muta- tions are responsible for 20%-35% of cases (Fassnacht et al., 2011). Furthermore, 80% of somatic mutations are linked to TP53 alteration that is caused by a loss of heterozygosity in the 17p13 chromosomal region. Li-Fraumeni syndrome is frequently associated with instances in children and germline TP53 mutations discovered in children account for half of its total percentage of ACC cases. The p53 (which is also termed TP53 in humans and Trp53 in mice), is a gene that codes for a protein located in the nucleus of all cells in the body that helps in the regulation of growth and multiplication of cells. TP53 mutations have been related to a range of malignancies, they are also the most commonly altered gene in human malignancies (Fassnacht et al., 2011).
Most of the mutant variants of p53 are generated by single amino acid mutations mapping to DNA binding sites (Xia et al., 2016). PKM2 is primarily found in cancer tissues and supports anabolic metabolism, overexpression of PKM2 resulted in a reduction of p53 level and a reduced p53 half-life. PKM2 depletion, on the other hand, resulted in higher p53 expression and a longer half-life for p53. PKM2 may bind to both MDM2 and p53, causing MDM2 to increase p53 ubiquitination. The dimer form of PKM2 mutant significantly reduce the expression of p53 when compared to the other form of PKM2 mutants. PKM2 interacts directly with the P53 protein, which is an important safeguard for genome stability. PKM2 blocks P53 from binding to the P21 promoter, preventing P53-dependent transactivation of the P21 gene and allowing the cell to enter G1 without interruption. As a result, tumor cells with PKM2 expression have a growth improvement in the presence of a DNA impair trigger, PKM2 also prevents P53 from being phosphorylated at ser15, which is known to produce higher P53 activity via the ATM (ataxia-telangiectasia mutated) (Xia et al., 2016). In a high oxidation
GSK-36
TCF/LEF
CKI
N-terminal ~ 150 AA
E-cadherin
C-terminal ~ 100 AA
Armadillo Repeats 550 AA
Degradation
Wnt signalling Pathway
Wnt
EGFR
in
FZD
yu
DVL
MAPK
CTNNB1
Axin
ß-Catenin
APC
GSK3฿
ERK-1/2
CTNNB1
ß-Catenin
[t]
PKM2 Ser 37
PKM2
CTNNB1 B-Catenin
Importin 5 a
PKM2
Pyruvate
CTNNB1
Warburg effect
B-Catenin
PKM2 GLUT1 LDH C-Myc
PKM2 Dimer
TCF/LEF
Lactate
Cancer cell Proliferation
state, the tetrameric form of PKM2 reduces p53 transcriptional activity and also reduced apoptosis, whereas, at a low oxidation state, it stim- ulates both. PKM2 monomers may bind with p53 and limit their tran- scriptional activity. P53 and PKM2 can phosphorylate each other in the nucleus of cells, forming a cascade loop. Although the position of the PKM2-phosphorylated TP53 modification site has not been convincingly confirmed, TP53 has been shown to phosphorylate the PKM2 at ser37. When tumor cells are stressed, this pattern is activated to protect them from external stress in the shape of EMT (Epithelial-mesenchymal transition).
PKM2 expression in the cytoplasm was more in adrenocortical car- cinoma affected tissues than in normal adrenal cortical tissues. P53 in mutated cancer cells activate different genes via mTOR/PKM2 pathway. Out of them, many genes are directly associated with the ACC including CCND1, ß-catenin, STAT3, p300 and HIF1a (Dando et al., 2016)The expression of CCND1 is assumed to be a sign of cell differentiation. CCND1 expression was observed to be lower in human ACC compared to other carcinomas, which supports this theory (Kool et al., 2015). CTNNB1 is a transcription factor that encodes ß-catenin and is involved in Wnt-ß-catenin signalling. CTNNB1 somatic mutations have been seen in adenomas as well as in ACCs (Kool et al., 2015). In ACC patients, STAT3 was substantially expressed which is activated via mTOR/PKM2 (Zhu et al., 2012). In the ACC cancer cell line H295R, hypoxia causes steroidogenic genes to be downregulated, while HIF1 regulates CYP19A1 downregulation by activating miR-98 (Watts et al., 2021) (Fig. 7).
6. Driver gene CCNE1 alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
6.1. Role of CCNE1 in G1/S phase succession
Mainly breast, ovary, gastric, lung carcinomas and adrenocortical carcinomas are related to the CCNE1 gene. Cyclin E1 (CCNE1), together with its catalytic subunit CDK2, is involved in maintaining cell cycle regulation, chromosomal segregation, DNA replication, and the transi- tion from G1 to S-phase. In high-grade adenocarcinoma, CCNE1 amplification is linked to primary treatment resistance (Massagué, 2004). To escape the G1-phase and enter into S-phase, eukaryotic cells must trigger CDK2 via phosphorylation of a region known as the T loop via contact with cyclin E1 (Koff et al., 1992). Several cellular processes maintain CDK2 inactive until mitogenic signals intrude, ensuring that the cell remains in the G1 phase. Cyclin E protein upregulation is centered on the G1/S phase changes, with accumulation beginning in early G1, a maximum in late G1, and a tipping point in G2/M (Murray, 2004).
6.2. Role of CCNE1 in oncogenesis
Overexpression of cyclin E1 speeds up the progression of cells past the G1/S phase restriction point, resulting in genomic instability (Spruck et al., 1999).Upregulation of CCNE1 disrupts origin firing and replica- tion progression, which harms DNA replication. Oncogene-induced replication stress is the result of this. When cyclin E is transfected, the number of polyploid cells formed at the time of mitosis increases rapidly (Rich, 2007). Mutational amplification of cyclin E, resulting in increased CDK2 activity that demonstrated to cause centrosome augmentation in
p53 mut
R175h / R273H
mTOR
PKM2
PKM2
HDAC3
PKM2
ß-catenin
ß -catenin
Cyclin D1
CCDN1
CCDN1
PKM2
PKM2
STAT3
STAT3
STAT3 target genes
PKM2
HIF1a
p300
HIF1a target gene
HRE
Nucleus
conjunction as a result of the deletion of p53. These anomalies are all over the place cyclin E1 accelerated carcinogenesis and impact (Taber- nero et al., 2013).
6.3. RB1 cell cycle/P53 apoptosis
The five families of proteins described in this article include D-type cyclins, cyclin-dependent protein kinases (cdk4, cdk6), CDKN, the RB- family of pocket proteins, and the E2F-family of transcription factors (heterodimers of E2F1-8 with DP1-2) (Sears et al., 1999). Because its components are triggered and/or repressed by both expansion and growth-inhibition signals, this route is critical for cell growth regulation. Following DNA damage, cyclin D1 is rapidly destroyed. Blocking cyclin D1 degradation in injured cells, on the other hand, causes abnormal cell cycle progression and a breakdown in genomic integrity (Knudsen and Wang, 2010). Cyclin D1 breakdown, p53-mediated overexpression of p21Cip1, and protein phosphatase activity all hinder cell cycle pro- gression by dephosphorylating and stimulating RB. Decreased cyclin D1 measure, decreased CDK4/6 activity, and consequent dephosphoryla- tion and/or stimulation of RB are all consequences of mitogenic sig- nalling attenuation. In this context, cyclin D1 is typically dysregulated by a combination of transcriptional and post-transcriptional mecha- nisms. Several nonproliferation stimuli elicit proteolytic turnover and/ or nuclear confinement of cyclin D1 (Pontano et al., 2008). Importantly, mitogenic signalling is required for the development of the cyclin D1- CDK4/6 complex. Uncontrolled cyclin D1 transcription has a clinical significance that might be extremely situation-dependent due to these various regulatory mechanisms (Fig. 8) (Agami and Bernards, 2000).
6.4. CCNE1 gene and its relation with PKM2
Switching metabolism from mitochondrial-dependent oxidative phosphorylation (OXPHOS) to glycolysis can restore RB shortage, which causes bioenergetic failure. This is evidence that pRb and E2F regulate the expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphospha- tase, a catalytic enzyme that catalyses the production and decomposi- tion of fructose-2,6-bisphosphate, a glycolytic stimulant. RB1 deficiency, on the other hand, may collaborate with oncogenic pathways that cause the Warburg effect, allowing cells to survive despite faulty OXPHOS caused by the absence of pRb. In pRb-deficient tumor cells, activation of these diminished mitochondrial function/OXPHOS, onco- genic pathways may allow persistence (Ciavarra and Zacksenhaus, 2011) (Fig. 9).
7. Driver gene TERF2 alteration in adrenocortical carcinoma (ACC) and its relation with PKM2
7.1. TERF2 overview
The telomere interfere with the distal ends of chromosomes to pre- vent DNA double-strand splits from being detected by DNA damage repair processes. To avoid DNA double-strand splits from being detected by DNA damage repair processes, the shelterin complex associates with chromosomal distal ends. The shelterin complex binds to the distal ends of chromosomes, preventing DNA damage repair processes from detecting them as double-strand splits. The telomeric repeat factor 2 (TERF2) is a component of the shelterin complex that interacts with
CDK inhibitors (P16/nk4a)
Stimulation of p53
p53
T
Inactivate
CELL CYCLE ARREST
Cyclin D/ CDK 4,6 Cyclin E (CCNE 1 gene)/ CDK2
P RB1
RB1
P
P
E2F
E2F
Hyperphosphorylated RB1
Hypophosphorylated RB1
CELL CYCLE PROGRESSION
Apoptosis
Diminution of RB
PRb
Glucose
Apoptosis
Cell death
Glucose
Glucose-6-phosphate
WARBURG EFFECT
Fructose-6- phosphate
Phosphofructokinase
Fructose 1,6-bisphosphate
Phosphoenolpyruvate (PEP)
ADP
PKM2 Tetramer
ATP
Pyruvate
PKM2 Dimer
Fig. 9. Multiple resistance pathways may work together to cause cancer when RB1 is lost. RB1 deficiency causes both cell growth and death. In the early stages of tumor development, the pathway works with pRb loss to prevent cell death caused by RB1 inactivation, which leads to neoplastic transformation and OXPHOS (oxidative phosphorylation).
chromosome distal ends to prevent DNA double-strand breaks from being recognized by DNA damage repair processes (Griffith et al., 1999). TRBF2, TRF2, and TERF2 are all acronyms for the same protein that the
TERF2 gene in humans encodes (Sfeir and De Lange, 2012). In TERF2 is the shelterin complex’s other subunits that have a relationship to telo- meric DNA. In healthy cells, TERF2 deficiency causes DNA repair
systems to activate primarily at telomeric loci, resulting in cell cycle arrest, ageing, and cell death. Overexpression of TERF2 in the skin, is linked to higher carcinogenesis. Upregulation of TERF2 has been discovered in a variety of human cancers, showing that TERF2 plays a role in tumor growth (Hu et al., 2010).
TERF2 has been implicated in the control of telomere length, albeit the primary function to shield telomeres from DNA repair processes, hence preventing chromosomal end aberrations. TERF2 has been shown to interact with several DNA-repair factors that have also been demon- strated to contribute to telomeres (De Semir et al., 2007). The bloom syndrome mutation (BLM), Werner syndrome mutation (WRN), Ku86 (DNA DSB repair), and Ataxia telangiectasia syndrome mutation (ATM) are among TERF2-interacting DNA-repair proteins that have been identified (De Lange, 2005). The fact that several TERF2-interacting proteins are involved in human chromosomal instability syndromes suggests that TRF2 may play a role in human disease as well. TERF2 is upregulated in several human cancers, which supports the liver, lung and gastric cancer. TERF2 is also upregulated in human skin cancers that may play a role in carcinogenesis (Muñoz et al., 2006).
7.2. TERF2 and its role in cancer
Short telomeres may play a dual function in carcinogenesis, as they can protect and promote cancer. The telomere loss has been shown to inhibit tumorigenesis in the lack of telomerase. Short telomeres are linked to chromosomal instability, which has been linked to an increased risk of cancer (Stewart and Weinberg, 2006).
Neoplasia is a complex process involving the aggregation of genetic and epigenetic changes that come together to generate aberrant cells. The hTERT gene, which codes for the catalytic component of the telo- merase holoenzyme, was cloned. Because hTERT is exhibited at higher levels in human tumors but healthy cells express in very minimal amounts of this enzyme, it seems plausible that telomerase activity would be necessary to transform a human cell. By expressing the SV40 related proteins repeat (LT), abdicating a protein phosphatase 2A (PP2A) function while also expressing the SV40 small t antigen (ST), and cellular immortalization by expressing hTERT mitogenic activation by oncogenic H-Ras expression. The human cell that has been transformed to be capable of tumor development was created. Low to undetectable amounts of the protein are expressed in normal human somatic cells. Inadequate telomerase activity to maintain telomere lengths, although
more than 90% of human tumor cell types studied exhibited high telo- merase activity and maintained telomerase lengths (Rheinwald et al., 2002)(Fig. 10).
7.3. TERF2 gene and its relation with PKM2
The Warburg effect is the phenomenon in which tumor cells have greater glycolysis rates compared to their non-transformed counter- parts. Inhibition of H-Ras, for example, inhibited glycolysis and increased cell death in a glioblastoma cell line. The inhibition of telo- merase resulted in the decreasing expression of glycolysis genes such phosphofructokinase and three aldolase isoforms. The stimulation of the Akt oncogene, which is required for cancer cells to transition to aerobic glycolysis, was explored further, and it was discovered that Akt activity makes cancer cells dependent on aerobic glycolysis (Gatenby and Gillies, 2004). The telomerase activity is increased by Akt-mediated activation of two Akt kinase phosphorylation unique sites in the hTERT compo- nent. This serine/threonine kinase has two substrates: Glycogen syn- thase kinase 3 (GSK3) and the isoenzyme 6-phosphofructo-2-kinase. Because telomerase is an Akt target protein, it is feasible that telomerase can serve as a vital link between Akt and the glycolytic process (Franke et al., 1997). As a result, telomerase may be solely engaged in the control of the glycolytic pathway in cancer cells (Rich, 2007)(Fig. 11).
8. Conclusion
While studying the alterations in different genes that lead to the formation of tumors in adrenal glands, and later on mature as carci- nomas of the adrenal cortex (ACCs), we came across a bunch of genes that were more prominently involved in ACCs amongst the whole pool. On exploring further their attributes, it was discovered that they have a close correlation with the terminal enzyme (PKM2) of the glycolytic pathway that furnishes pyruvate from phosphoenolpyruvate. It was hence observed that the dimeric form of the PKM2, when expressed beyond a limit leads to certain nicks and cuts in these driver genes that mark the onset of ACCs. Thus, on proceeding further, it could be stated that three pathways which include the ß-catenin pathway (ZNRF3 and CTNNB1), the p53/Rb signalling pathway (TP53), the chromatin remodelling pathway and the cAMP/PKA signalling pathway (PRKAR1A) are the vulnerable pieces that are linked with PKM2 over- expression (dimeric) acting as a deciding factor for the onset of ACCs.
€
p53
NORMAL CELL
Large t
Rb
K
Oncogenic component hTERT and H-ras of Telomerase holoenzyme
Inactivation of p53, Rb and PP2A
SV40
PP2A
Small t
Antigens
Fig. 10. Human cells are transformed in vitro. A group of introduced, defined genetic elements can change normal human cells. In infected mice, clones expressing the SV40 Large T and small T antigens (which functionally inactivate p53, Rb, and PP2A), oncogenic H-Ras, and the hTERT active subunit of the telomerase ligase cause anchorage-independent growth and tumor formation.
CANCEROUS CELL
TTĄGGGTTAGGGTTAGGGG3’
X
Telomere shortening
Telomerase activation and cancer Increase telomere length, increase of hTERT mRNA
Anti-cancer Decrease telomere length, inhibition of hTERT mRNA
WRN
BLM
TERF2
Ku86
ATM
TAGGGTTAGGGTTAGGGGTTAGGGTTAGGG3’
H
,Telomere lengthening
Glucose
Glucose
Glucose-6-phosphate
Glyceraldehyde-3- phosphate
Fructose-6- phosphate
Phosphofructokinase
1
Phosphotriose isomerase
Aldolase
Fructose 1,6-bisphosphate
WARBURG EFFECT
Dihydroxyacetone phosphate
Phosphoenolpyruvate (PEP)
ADP
PKM2 Tetramer
ATP
Pyruvate
PKM2 Dimer
Discussing these driver genes in detail may help bridge the lacunae between the driver genes, ACCs and PKM2 and aid in combating this disease at the genomic level.
Further, identification and henceforth validation of genes indis- pensably correlated with the disease are attractive targets in drug dis- covery. With intractable cancers like ACC, the relationship of its genes with other proteins should be established. It is worth exploring if the PKM2 modulators developed to date have any positive effect on allevi- ating the ACCs. This review sheds light on the correlation between the genes and PKM2. It is speculated that large-scale multi-omics initiatives may help in a better understanding of ACCs. It may also offer a fresh view of possible molecular mechanisms of the disease. The selection of a small number of genes of ACCs and their correlation with PKM2 further necessitates an in-depth biological validation. This will altogether eliminate the chances of running a biased study, overlooking potentially druggable and therapeutically novel targets. Further, medicinal chem- ists need to assess the biological relevance of targets in ACCs versus synthesis feasibility and flexibility of drug design approaches towards chemical diversification or library synthesis. We hereby strongly advo- cate for in-depth chemical and biological studies.
Declaration
Ethics approval and consent to participate: Not applicable.
Consent for publication: Not Applicable.
Availability of data and materials: Not applicable.
Code availability: Not applicable.
Competing interests: Authors have no competing interests.
Funding information: Authors RD, MGC, SR, JJ, NK, SP and AS are thankful to NIPER Ahmedabad, Department of Pharmaceuticals, Min- istry of Chemicals and Fertilizers, Government of India for their fellowships.
Author contributions:
Dr Amit Shard has conceptualized and designed the effect of specific genetic alterations and the role of PKM2 in ACCs. Rudradip Das did the thorough literature survey, data curation and manuscript preparation and graphical formatting. Moumita Ghosh Chowdhury wrote about the role of CCNE1 and TERF2 alteration in ACCs and their relation to PKM2. Sonal Raundal wrote about the role of ZNRF3 and CTNNB1 alteration in ACCs and their relation to PKM2. Jyotika Jadhav wrote about the role of PRKAR-1A and CTNNB1 alteration in ACCs and their relation to PKM2. Navin Kumar wrote about the role of TP53 alteration in ACCs and its relation to PKM2. Sagarkumar Patel did the literature survey and wrote the introductory parts of this manuscript.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
The authors gratefully acknowledge Director, NIPER-Ahmedabad for all the support and encouragement. The communication number for this manuscript is NIPER-A/628/10/2021.
References
Agami, R., Bernards, R., 2000. Distinct initiation and maintenance mechanisms cooperate to induce G1 cell cycle arrest in response to DNA damage. Cell 102 (1), 55-66.
Anselmo, J., Medeiros, S., Carneiro, V., Greene, E., Levy, I., Nesterova, M., Lyssikatos, C., Horvath, A., Carney, J.A., Stratakis, C.A., 2012. A large family with Carney complex
caused by the S147G PRKAR1A mutation shows a unique spectrum of disease including adrenocortical cancer. J. Clin. Endocrinol. Metab. 97, 351-359.
Armignacco, R., Cantini, G., Canu, L., Poli, G., Ercolino, T., Mannelli, M., Luconi, M., 2018. Adrenocortical carcinoma: the dawn of a new era of genomic and molecular biology analysis. J. Endocrinol. Invest. 41, 499-507.
Assié, G., Letouzé, E., Fassnacht, M., Jouinot, A., Luscap, W., Barreau, O., Omeiri, H., Rodriguez, S., Perlemoine, K., René-Corail, F., 2014. Integrated genomic characterization of adrenocortical carcinoma. Nat. Genet. 46, 607-612.
Basham, K.J., Rodriguez, S., Turcu, A.F., Lerario, A.M., Logan, C.Y., Rysztak, M.R., Gomez-Sanchez, C.E., Breault, D.T., Koo, B .- K., Clevers, H., 2019. A ZNRF3- dependent Wnt/ß-catenin signaling gradient is required for adrenal homeostasis. Genes Dev. 33, 209-220.
Basso, F., Rocchetti, F., Rodriguez, S., Nesterova, M., Cormier, F., Stratakis, C.A., Ragazzon, B., Bertherat, J., Rizk-Rabin, M., 2014. Comparison of the effects of PRKAR1A and PRKAR2B depletion on signaling pathways, cell growth, and cell cycle control of adrenocortical cells. Horm. Metab. Res. 46, 883-888.
Bedrose, S., Daher, M., Altameemi, L., Habra, M.A., 2020. Adjuvant therapy in adrenocortical carcinoma: reflections and future directions. Cancers (Basel) 12, 1-12.
Bertherat, J., 2012. Adrenocortical cancer in Carney complex: a paradigm of endocrine tumor progression or an association of genetic predisposing factors? J. Clin. Endocrinol. Metab. 97, 387-390.
Bonnet-Serrano, F., Bertherat, J., 2018. Genetics of tumors of the adrenal cortex. Endocr. Relat. Cancer 25, 131-152.
Bossis, I., Stratakis, C.A., 2004. Minireview: PRKAR1A: normal and abnormal functions. Endocrinology 145, 5452-5458.
Calissendorff, J., Calissendorff, F., Falhammar, H., 2016. Adrenocortical cancer: mortality, hormone secretion, proliferation and urine steroids-experience from a single centre spanning three decades. BMC Endocr. Disord. 16, 1-7.
Chen, X., Chen, S., Yu, D., 2020. Protein kinase function of pyruvate kinase M2 and cancer. Cancer Cell Int. 20, 1-11.
Ciavarra, G., Zacksenhaus, E., 2011. Multiple pathways counteract cell death induced by RB1 loss: implications for cancer. Cell Cycle 10 (10), 1533-1539.
Crawford, A., Harris, H., 2012. Adrenal cortex disorders: hormones out of kilter. Nursing 2020 42, 32-38.
Crona, J., Beuschlein, F., 2019. Adrenocortical carcinoma - towards genomics guided clinical care. Nat. Rev. Endocrinol. 15, 548-560.
Dando, I., Cordani, M., Donadelli, M., 2016. Mutant p53 and mTOR/PKM2 regulation in cancer cells. IUBMB Life 68, 722-726.
De Lange, T., 2005. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev. 19, 2100-2110.
De Semir, D., Nosrati, M., Li, S., Kashani-Sabet, M., 2007. Telomerase: going beyond the ends. Cell Cycle 6, 546-549.
Duan, K., Gucer, H., Kefeli, M., Asa, S.L., Winer, D.A., Mete, O., 2020. Immunohistochemical Analysis of the Metabolic Phenotype of Adrenal Cortical Carcinoma. Endocr. Pathol. 31, 231-238.
Durand, J., Lampron, A., Mazzuco, T.L., Chapman, A., Bourdeau, I., 2011. Characterization of differential gene expression in adrenocortical tumors harboring B-catenin (CTNNB1) mutations. J. Clin. Endocrinol. Metab. 96, 1206-1211.
Else, T., Kim, A.C., Sabolch, A., Raymond, V.M., Kandathil, A., Caoili, E.M., Jolly, S., Miller, B.S., Giordano, T.J., Hammer, G.D., 2014. Adrenocortical carcinoma. Endocr. Rev. 35, 282-326.
Fassnacht, M., Libé, R., Kroiss, M., Allolio, B., 2011. Adrenocortical carcinoma: a clinician’s update. Nat. Rev. Endocrinol. 7, 323-335.
Franke, T.F., Kaplan, D.R., Cantley, L.C., 1997. PI3K: downstream AKTion blocks apoptosis. Cell 88, 435-437.
Gao, C., Wang, Y., Broaddus, R., Sun, L., Xue, F., Zhang, W., 2018. Exon 3 mutations of CTNNB1 drive tumorigenesis: a review. Oncotarget 9, 5492-5508.
Gatenby, R.A., Gillies, R.J., 2004. Why do cancers have high aerobic glycolysis? Nat. Rev. cancer 4, 891-899.
Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H., De Lange, T., 1999. Mammalian telomeres end in a large duplex loop. Cell 97, 503-514. Hao, H .- X., Jiang, X., Cong, F., (Basel).2016,. Control of Wnt receptor turnover by R- spondin-ZNRF3/RNF43 signaling module and its dysregulation in cancer. Cancers 8, 1-12.
Hu, H., Zhang, Y., Zou, M., Yang, S., Liang, X .- Q., 2010. Expression of TRF1, TRF2, TIN2, TERT, KU70, and BRCA1 proteins is associated with telomere shortening and may contribute to multistage carcinogenesis of gastric cancer. J. Cancer Res. Clin. Oncol. 136, 1407-1414.
Kjellman, M., Roshani, L., Teh, B.T., Kallioniemi, O .- P., Höög, A., Gray, S., Farnebo, L .- O., Holst, M., Bäckdahl, M., Larsson, C., 1999. Genotyping of adrenocortical tumors: very frequent deletions of the MEN1 locus in 11q13 and of a 1-centimorgan region in 2p16. J. Clin. Endocrinol. Metab. 84, 730-735.
Knudsen, E.S., Wang, J.Y.J., 2010. Targeting the RB-pathway in cancer therapy. Clin. Cancer Res. 16, 1094-1099.
Koff, A., Giordano, A., Desai, D., Yamashita, K., Harper, J.W., Elledge, S., Nishimoto, T., Morgan, D.O., Franza, B.R., Roberts, J.M., 1992. Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle. Science. 257, 1689-1694.
Komiya, I., Koizumi, Y., Kobayashi, R., Kotani, M., Yamada, T., Maruyama, Y., 1979. Concurrent hypersecretion of aldosterone and cortisol from the adrenal cortical adenoma. Am. J. Med. 67, 516-518.
Kool, M.M.J., Galac, S., Van Der Helm, N., Corradini, S., Kooistra, H.S., Mol, J.A., 2015. Insulin-Like Growth Factor-Phosphatidylinositol 3 Kinase Signaling in Canine Cortisol-Secreting Adrenocortical Tumors. J. Vet. Intern. Med. 29, 214-224.
Korpaisarn, S., Trachoo, O., Panthan, B., Aroonroch, R., Suvikapakornkul, R.,
Sriphrapradang, C., 2017. A novel PRKAR1A mutation identified in a patient with isolated primary pigmented nodular adrenocortical disease. Case Rep. Oncol. 10, 769-776.
Libé, R., 2015. Adrenocortical carcinoma (ACC): diagnosis, prognosis, and treatment. Front. Cell Dev. Biol. 3, 45.
Luton, J.P., Cerdas, S., Billaud, L., Thomas, G., Guilhaume, B., Bertagna, X., Laudat, M. H., Louvel, A., Chapuis, Y., Blondeau, P., 1990. Adrenocortical carcinoma: Clinical features, prognostic factors and therapeutic results in 105 patients from a single center (1963-1987). New Engl J Med 322, 1195-1201.
Maharjan, R., Backman, S., Åkerström, T., Hellman, P., Björklund, P., 2018.
Comprehensive analysis of CTNNB1 in adrenocortical carcinomas: Identification of novel mutations and correlation to survival. Sci. Rep. 8, 1-10.
Martin-Orozco, E., Sanchez-Fernandez, A., Ortiz-Parra, I., Nicolas, A .- S., 2019. WNT signaling in tumors: the way to evade drugs and immunity. Front. Immunol. 10, 1-21.
Massagué, J., 2004. G1 cell-cycle control and cancer. Nature 432 (7015), 298-306. McNicol, A.M., 2008. Lesions of the adrenal cortex. Arch. Pathol. Lab. Med. 132, 1263-1271.
Mo, Y., Wang, Y., Zhang, L., Yang, L., Zhou, M., Li, X., Li, Y., Li, G., Zeng, Z., Xiong, W., 2019. The role of Wnt signaling pathway in tumor metabolic reprogramming. J. Cancer 10, 1-9.
Muñoz, P., Blanco, R., Blasco, M.A., 2006. Role of the TRF2 telomeric protein in cancer and aging. Cell Cycle 5, 718-721.
Murray, A.W., 2004. Recycling the cell cycle: cyclins revisited. Cell 116 (2), 221-234.
Patel, S., Das, A., Meshram, P., Sharma, A., Chowdhury, A., Jariyal, H., Datta, A., Sarmah, D., Nalla, L.V., Sahu, B., Khairnar, A., Bhattacharya, P., Srivastava, A., Shard, A., 2021. Pyruvate kinase M2 in chronic inflammations: a potpourri of crucial protein-protein interactions. Cell Biol. Toxicol. 37 (5), 653-678. https://doi.org/ 10.1007/s10565-021-09605-0.
Pontano, L.L., Aggarwal, P., Barbash, O., Brown, E.J., Bassing, C.H., Diehl, J.A., 2008. Genotoxic stress-induced cyclin D1 phosphorylation and proteolysis are required for genomic stability. Mol. Cell. Biol. 28, 7245-7258.
Puckett, D.L., Alquraishi, M., Chowanadisai, W., Bettaieb, A., 2021. The role of PKM2 in metabolic reprogramming: Insights into the regulatory roles of non-coding RNAs. Int. J. Mol. Sci. 22, 1-55.
Rheinwald, J.G., Hahn, W.C., Ramsey, M.R., Wu, J.Y., Guo, Z., Tsao, H., De Luca, M., Catricalà, C., O’Toole, K.M., 2002. A two-stage, p16INK4A-and p53-dependent keratinocyte senescence mechanism that limits replicative potential independent of telomere status. Mol. Cell. Biol. 22, 5157-5172.
Rich, J.N., 2007. Cancer stem cells in radiation resistance. Cancer Res. 67, 8980-8984.
Rihan, M., Nalla, L.V., Dharavath, A., Shard, A., Kalia, K., Khairnar, A., 2019. Pyruvate kinase M2: a metabolic bug in re-wiring the tumor microenvironment. Cancer Microenviron. 12, 149-167.
Sahbaz, N.A., Dural, A.C., Akarsu, C., Guzey, D., Kulus, M., Dogansen, S.C., Mert, M., Alis, H., 2020. Transperitoneal laparoscopic surgery in large adrenal masses. Videosurgery Other Miniinvasive Tech. 15 (1), 106-111.
Schiavone, D., Torresan, F., Negro, S., Belluzzi, A., Iacobone, M., 2019. Adrenal malignancy: still a contraindication for laparoscopy? Imaging 16, 22.
Sears, R., Leone, G., DeGregori, J., 1999. Ras enhances Myc protein stability. Mol Cell 3, 169-179.
Sfeir, A., De Lange, T., 2012. Removal of shelterin reveals the telomere end-protection problem. Science. 336, 593-597.
Spruck, C.H., Won, K .- A., Reed, S.I., 1999. Deregulated cyclin E induces chromosome instability. Nature 401, 297-300.
Stewart, S.A., Weinberg, R.A., 2006. Telomeres: cancer to human aging. Annu. Rev. Cell Dev. Biol. 22, 531-557.
Tabernero, J., Shapiro, G.I., LoRusso, P.M., Cervantes, A., Schwartz, G.K., Weiss, G.J., Paz-Ares, L., Cho, D.C., Infante, J.R., Alsina, M., 2013. First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP in cancer patients with liver involvement. Cancer Discov. 3, 406-417.
Torti, J.F., Adrenal, C.R., 2021. Cancer 1-10.
Veytsman, I., Nieman, L., Fojo, T., 2009. Management of endocrine manifestations and the use of mitotane as a chemotherapeutic agent for adrenocortical carcinoma. J. Clin. Oncol. 27, 4619-4629.
Watts, D., Stein, J., Meneses, A., Bechmann, N., Neuwirth, A., Kaden, D., Krüger, A., Sinha, A., Alexaki, V.I., Perez-Rivas, L.G., 2021. HIF1« is a direct regulator of steroidogenesis in the adrenal gland. Cell. Mol. Life Sci. 78, 3577-3590.
Wong, N., De Melo, J., Tang, D., 2013. PKM2, a central point of regulation in cancer metabolism. Int. J. Cell Biol. 2013, 1-12.
Xia, L., Wang, X .- R., Wang, X .- L., Liu, S .- H., Ding, X .- W., Chen, G .- Q., Lu, Y., 2016. A novel role for pyruvate kinase M2 as a corepressor for P53 during the DNA damage response in human tumor cells. J. Biol. Chem. 291, 26138-26150.
Yan, X., Guo, Z .- X., Yu, D .- H., Chen, C., Liu, X .- P., Yang, Z .- W., Liu, T .- Z., Li, S., 2021. Identification and Validation of a Novel Prognosis Prediction Model in Adrenocortical Carcinoma by Integrative Bioinformatics Analysis, Statistics, and Machine Learning. Front. Cell Dev. Biol. 9, 1-19.
Yang, W., Zheng, Y., Xia, Y., Ji, H., Chen, X., Guo, F., Lyssiotis, C.A., Aldape, K., Cantley, L.C., Lu, Z., 2012. ERK1/2-dependent phosphorylation and nuclear translocation of PKM2 promotes the Warburg effect. Nat. Cell Biol. 14, 1295-1304.
Zhang, Z., Deng, X., Liu, Y., Liu, Y., Sun, L., Chen, F., 2019. PKM2, function and expression and regulation. Cell Biosci. 9, 1-25. https://doi.org/10.1186/s13578- 019-0317-8.
Zhang, J., Yu, P., Zhou, Q., Li, X., Ding, S., Su, S., Zhang, X., Yang, X., Zhou, W., Wan, Q., 2018. Screening and characterisation of sex differentiation-related long non-coding RNAs in Chinese soft-shell turtle (Pelodiscus sinensis). Sci. Rep. 8, 1-10.
Zheng, S., Cherniack, A.D., Dewal, N., Moffitt, R.A., Danilova, L., Murray, B.A., Lerario, A.M., Else, T., Knijnenburg, T.A., Ciriello, G., 2016. Comprehensive pan- genomic characterization of adrenocortical carcinoma. Cancer Cell 29, 723-736.
Zhu, Y., Sheng, J .- Y., Xu, Y .- Z., Wu, Y .- X., Zhao, J .- P., He, H .- C., Yuan, F., Rui, W .- B., Zhang, C .- Y., Ji, J., 2012. Relationship of STAT3, VEGF and MVD expression in adrenal cortical carcinoma. Transl. Androl. Urol. 1, 1-12.