Potential role of increased oxygenation in altering perinatal adrenal steroidogenesis

Vishal Agrawal1, Meng Kian Tee1, Jie Qiao1, Marcus O. Muench2,3 and Walter L. Miller1

BACKGROUND: At birth, the large fetal adrenal involutes rap- idly, and the patterns of steroidogenesis change dramatically; the event(s) triggering these changes remain largely unex- plored. Fetal abdominal viscera receive hypoxic blood having a partial pressure of oxygen of only ~2 kPa (20-23 mm Hg); peri- natal circulatory changes change this to adult values (~20 kPa). We hypothesized that transition from fetal hypoxia to postna- tal normoxia participates in altering perinatal steroidogenesis. METHODS: We grew midgestation human fetal adrenal cells and human NCI-H295A adrenocortical carcinoma cells in 2% O2, then transitioned them to 20% O2 and quantitated ste- roidogenic mRNAs by quantitative PCR and microarrays.

RESULTS: Transitioning fetal adrenal cells from hypoxia to normoxia increased mRNAs for 17a-hydroxylase/17,20 lyase (P450c17), 3ß-hydroxysteroid dehydrogenase (3ßHSD2), and steroidogenic acute regulatory protein (StAR). We repeated the protocol with NCI-H295A cells acclimated to hypoxia for 15 d, quantitating 31,255 transcripts by microarray. Using an arbitrary 1.5-fold difference, 1 d of normoxia increased 4 tran- scripts and decreased 56, whereas 2 d of normoxia increased 62 transcripts and decreased 105. P450c17, 3ßHSD2, and StAR were ranked among the top eight increased transcripts.

CONCLUSION: These data suggest that the hypoxic/nor- moxic transition at birth contributes to perinatal changes in adrenal steroidogenesis.

A t birth, the transition from intrauterine to extrauterine life requires major endocrine adjustments, such as the meta- bolic adjustments following the discontinuation of glucose supplied from cord blood and the rapid shift from producing reverse T3 to T3. Understanding these transitions is essential in the endocrine care of the perinatal patient. Evaluation of newborn adrenal function is complicated by the fact that the fetal and later infant adrenals are very different. The human fetal adrenal has two zones, fetal and definitive, in contrast to the three zones, glomerulosa, fasciculata, and reticularis, of the adult gland. Fetal adrenal steroidogenesis begins at about 7 wk gestation: steroidogenic enzymes are detectable by immu- nocytochemistry in the fetal zone at 50-52 d postconception, and primary cultures of the 8 wk adrenal produce cortisol and

respond to adrenocorticotropic hormone (1). The fetal adrenal transiently expresses 3ß-hydroxysteroid dehydrogenase, type 2 (3ßHSD2, encoded by HSD3B2) at about 8-10 wk, permit- ting fetal adrenal cortisol synthesis at the same time when male genital development occurs, thus helping to prevent the viril- ization of female fetuses by suppressing fetal adrenal andro- gen synthesis (1). The fetal adrenal has relatively little 3ßHSD2 activity after 12 wk (1,2) but has 17a-hydroxylase and robust 17,20 lyase activity (both catalyzed by cytochrome P450c17, encoded by CYP17A1), considerable sulfotransferase activity, and little steroid sulfatase activity accounting for its abun- dant production of dehydroepiandrosterone (DHEA) and its sulfate (DHEAS). DHEAS is secreted, 16a-hydroxylated in the fetal liver by CYP3A7 (3-5), and then acted on by pla- cental 3ßHSD1, 17ßHSD1 (17ß-hydroxysteroid dehydroge- nase type 1, encoded by HSD17B1), and aromatase (P450aro, encoded by CYP19A1) to produce estriol (6,7). Fetal adrenal steroids are the source of about half of the estrone and estradiol and 90% of the estriol in the maternal circulation (8). Despite the large amounts of DHEA and DHEAS produced by the fetal adrenal and their consequent metabolism to estrogens by the placenta, evidence for an essential role for these steroids is scant, as fetuses with genetic disorders of adrenal steroido- genesis develop normally, reach term gestation, and undergo normal parturition (9). Although glucocorticoids can induce premature lung maturation, they do not appear to be needed when human gestation goes to term, as complete absence of the glucocorticoid receptor is compatible with normal term birth and pulmonary function (10).

It has long been known that the adrenal grows rapidly through- out fetal life, reaching a combined weight of 8-9 g at birth (equal to the combined weight of the adult adrenals) (11-13), but within weeks of birth, the fetal adrenals involute to a total weight of about 2g (12,14). This change is mediated by apoptosis of the fetal zone, possibly in response to activin A or transforming growth factor-ß (15). In parallel with the involution of the fetal zone of the adre- nal, secretion of DHEA and DHEAS falls dramatically (16-18). The triggering mechanism for this rapid, profound change in adrenal morphology, cellular architecture, and steroidogenesis is not known. It has been suggested that the involution of the fetal adrenal is more related to gestational age than to timing

The first two authors contributed equally to this work.

1Department of Pediatrics, University of California-San Francisco, San Francisco, California; 2Blood Systems Research Institute, University of California-San Francisco, San Francisco, California; 3Department of Laboratory Medicine, University of California-San Francisco, San Francisco, California. Correspondence: Walter L. Miller (wlmlab@ucsf.edu) Received 9 June 2014; accepted 13 August 2014; advance online publication 24 December 2014. doi:10.1038/pr.2014.194

after birth (19), but more recent studies indicate that parturition itself triggers fetal adrenal involution, which was interpreted as suggesting that the withdrawal of a placental factor stimulated the onset of fetal adrenal apoptosis (20). We hypothesize that the transition from intrauterine hypoxia to extrauterine normoxia is also a key event in triggering the remodeling of the fetal adrenal. Human fetal abdominal viscera receive hypoxic blood having a partial pressure of oxygen (Po2) of only ~2 kPa (1 kPa = 7.5 Torr; 1 Torr = 1 mm Hg); perinatal circulatory changes change this to adult values of ~20 kPa. As parturition itself appears to trigger the changes in fetal adrenal steroidogenesis and architecture, we considered whether the perinatal change in arterial oxygen ten- sion participates in these changes. As a preliminary test of this hypothesis, we grew adrenal cells in long-term hypoxic condi- tions designed to mimic the intrauterine environment and then examined changes in gene expression upon transition to a nor- moxic environment that models extrauterine life.

RESULTS

Human Fetal Adrenal Cells

To study the changes in the human adrenal as it transitions from the hypoxia of fetal life to the normoxia of the extrauterine new- born environment, we first incubated adrenal cells from a single 17-wk human fetus under hypoxic conditions for 1 d, followed by normoxic conditions for 1 or 2 d. Total cellular RNA from these cells was hybridized to Illumina BeadChip microarrays for gene expression analyses. Using an arbitrary cutoff of >1.5-fold change for gene activation or <0.67-fold change for gene repres- sion, the mRNAs encoded by 107 genes were increased, and those for 114 genes were decreased when the cells were shifted from fetal hypoxic conditions to normoxic conditions for 1 d, and 179 mRNAs were increased and 296 genes were decreased after 2 d in normoxic conditions (Supplementary Tables S1

a

Total number of genes activated or inhibited in fetal adrenal cells in normoxia over control in hypoxia: 1 d normoxia, 221 genes (107 1 + 114 4) 2 d normoxia, 475 genes (179 1 + 296 4)

b

Figure 1. Summary of microarray gene expression profiles from the pri- mary culture of human fetal adrenal cells. A primary culture of fetal adrenal cells was incubated under hypoxic conditions for 1 d, followed by normoxic conditions for either 1 or 2 d; control cells were maintained under hypoxic conditions throughout the experiment. (a) Gene expression levels were cal- culated as the signal levels under normoxic conditions divided by the signal levels under hypoxic conditions for control cells. (b) Venn diagram showing gene expression profiles in the primary culture of fetal adrenal cells incu- bated under the above conditions. Arrows pointing upward and downward represent increased and decreased numbers of expressed genes.

Adrenal 1 d

Adrenal 2 d

53 1 34

54 1 111 Į

125 1 185

and S2 online). Of these transcripts, 54 were increased and 111 were decreased on both days (Figure 1).

While this experiment showed that the hypoxic-normoxic transition can change the abundance of many adrenal mRNAs, changes were not seen in the transcripts for any gene encod- ing a steroidogenic enzyme or its electron-transfer cofactor. To examine mRNAs encoding steroidogenic factors more closely, we obtained additional adrenals, incubated primary adrenal cell cultures under hypoxic and normoxic conditions, and mea- sured the relative abundances of selected mRNAs under each condition for each adrenal by reverse transcription followed by quantitative real-time PCR. Consistent with prior observa- tions (21), preliminary experiments showed that the relative abundances of mRNAs for P450scc and P450c17 decreased after 4 d due to the overgrowth of fibroblasts and apoptosis of fetal adrenal cells (data not shown). Thus, we used 2 d of cul- ture for more detailed studies with adrenals from five fetuses (three male and two female; 17-23 wk gestation). We noted no changes in the morphology of the adrenal cells after transition from hypoxia to normoxia for 1-2 d. Under normoxic con- ditions, the abundance of the mRNAs for P450c17, steroido- genic acute regulatory protein (StAR), and 3ßHSD2 increased after 2 d (Figure 2). Consistent with the data from other cell types (22), glyceraldehyde-3-phosphate dehydrogenase gene expression decreased in normoxia compared with hypoxia, but the expression of mRNAs for 3ßHSD2, StAR, and P450c17 increased 2.6-, 2.0-, and 1.6-fold under normoxic conditions, while expression of P450scc barely changed. However, there was a substantial variation with the fetal adrenal cells from dif- ferent fetuses, so that the statistical analyses were of marginal significance.

Human Adrenal NCI-H295A Cells

To avoid differences between individual fetal adrenals, we sought to use the immortalized human adrenal NCI-H295A cell line, in which the patterns of steroidogenesis closely

Figure 2. Expression of mRNAs in human fetal adrenal cells. Duplicate cultures of five fetal adrenals were grown in conditions of hypoxia (open bars) and normoxia (closed bars), and the mRNAs for P450c17, StAR, 3฿HSD2, P450scc, and GAPDH were quantitated by qPCR. The mean levels in hypoxia are set at 100% for each RNA; data are mean ± SEM; * P < 0.05. 3฿HSD2, 3ß-hydroxysteroid dehydrogenase, type 2; GAPDH, glyceralde- hyde-3-phosphate dehydrogenase; P450c17, 17a-hydroxylase/17,20 lyase; qPCR, quantitative PCR; StAR, steroidogenic acute regulatory protein.

5

T

mRNA fold change (2-44Ct)

4

3

*

2

1

T

*

T

0

P450c17

StAR

3฿HSD2

P450scc

GAPDH

Articles

resemble those of the fetal adrenal (23). Because these cells are normally cultured in normoxic conditions, we first acclimated them to the fetal environment by culturing them in hypoxic conditions for 15 d before “delivering” them to extrauterine normoxic conditions for either 1 or 2 d; control cells were maintained in hypoxic conditions throughout the experiment. We noted no changes in cellular morphology when the NCI- H295A cells were transitioned from 15 d of hypoxia to nor- moxia. The resulting mRNAs were analyzed by hybridization to Illumina BeadChip microarrays, thus permitting analysis of the entire transcriptome. In NCI-H295A cells, only 4 mRNAs were increased and 56 were decreased when the cells were shifted from fetal hypoxic conditions to extrauterine normoxic conditions for 1 d, and none of the altered mRNAs appeared to participate in steroidogenesis (Table 1 and Supplementary Table S3 online). By contrast, after the NCI-H295A cells had been returned to normoxia for 2 d, 62 mRNAs were increased and 105 mRNAs were decreased (Table 2 and Supplementary Table S3 online). Among the mRNAs that increased, three encode proteins that participate in steroidogenesis: P450c17 (CYP17A1), increased 1.65-fold; 3ßHSD2 (HSD3B2), increased 1.89-fold; and StAR (STAR), increased 1.78-fold over con- trols. In addition, sterol isomerase (EBP), which participates in cholesterol biosynthesis, increased 1.57-fold. The degree of overlap in these gene populations is shown in Figure 3. These gene expression profiles showed that 46 mRNAs were regu- lated in the same fashion after both 1 and 2 days of normoxia (1 increased and 45 decreased). In addition, the mRNAs for 3 other genes were increased and 11 were decreased after 1 d of normoxia and 61 mRNAs were increased and 60 reduced after 2 d of normoxia.

Among the genes whose mRNAs increased or decreased under normoxic conditions (Tables 1 and 2), ALDOA, ALDOC, BNIP3, BNIP3L, CA9, ENO1, GADPH, HK2, IGFBP2, JMJDIA, LDHA, NDRG1, PKM2, SLC2A1, SLC2A3, and TPI1 are known to be transcriptionally regulated by hypoxia (24). Only four genes, BNIP3, NDRG1, SERPINA3, and SLC2A1 were regulated in common in both NCI-H295A cells and in the primary culture of fetal adrenal cells. The complete expression profile data for all genes in NCI-H295A and in the primary cultures of fetal adrenal cells are shown in Supplementary Tables S1-S4 online.

Gene ontology analyses using Ingenuity Pathway Analysis (https://analysis.ingenuity.com) showed that many of the repressed genes in NCI-H295A incubated for 1 or 2 d in nor- moxic conditions participate in common pathways such as glycolysis, sucrose degradation, vitamin C transport, thyroid hormone receptor/retinoid X receptor activation, and HIFlo signaling (Tables 3-5). In contrast, the activated genes in NCI- H295A are involved in glutathione-mediated detoxification, dendritic-natural killer cells crosstalk, p53 signaling, and, of course, steroidogenesis.

DISCUSSION

Little information is available concerning the potential effects of environmental oxygenation on fetal adrenal function, and

most such reports have investigated animal models of high- altitude stress. Thus, when pregnant rats were transitioned to reduced air pressure of ~380 Torr (~50 kPa; Po, ~10 kPa; designed to correspond to 18,000 feet above sea level), the adrenals of fetuses were larger, possibly due to increased adre- nocorticotropic hormone secretion (25). Long-term mainte- nance of pregnant sheep at 3,820 m above sea level (Po2 ~102 Torr; 13.6 kPa) reduced expression of mRNAs and proteins for P450scc, P450c17, and MC2R (adrenocorticotropic hor- mone receptor) but did not alter P450c21 (21-hydroxylase, encoded by CYP21A2), StAR (encoded by STAR), 3ßHSD2, or DAX-1 (26). At birth, the fetal zone of the human adrenal cor- tex involutes rapidly, as evidenced by rapidly declining serum concentrations of DHEA and DHEAS. Furthermore, this rapid decline in DHEA/S is seen in both premature and term infants (27). Therefore, we and others have hypothesized that the involution of the fetal adrenal is not “programmed” but “triggered.” A current view is that the trigger is the loss of pla- cental hormones and growth factors (20). Such a trigger could also be secondary to the profound environmental change that accompanies birth. Such changes initiate the transition from fetal to postnatal circulatory patterns, including closure of the foramen ovale and the ductus arteriosus. Closure of the ductus is directly triggered by increased oxygen tension (via prosta- glandins), and many other events in the newborn are triggered by the transition to normoxia (28). Thus, we hypothesized that the transition from the intrauterine hypoxic environment to the extrauterine normoxic environment might participate in initiating the rapid changes in adrenal steroidogenesis that follow birth. The fetal adrenal and other organs served by the fetal abdominal aorta are bathed in oxygen-poor blood having a partial pressure of oxygen of about 20-22 Torr (2.6-2.9 kPa) (29). Therefore, to model the changes in the adrenal environ- ment that accompany birth, we incubated human fetal adre- nal cells and human adrenal NCI-H295A cells in 2% oxygen (hypoxia, Po2 ~2.0 kPa) followed by incubation in atmospheric oxygen (normoxia, ~20 kPa) for 1 and 2 d.

Results with human fetal adrenals suggested that the hypoxic-normoxic transition increased the mRNAs for StAR, 3ßHSD2, and P450c17 and decreased the mRNA for P450scc, but only the data with StAR reached nominal significance of P < 0.05. There was substantial variation among adrenals from different donors, with no pattern attributable to donor sex or gestational age in the 17-23-wk period used. Therefore, we turned to human adrenocortical carcinoma NCI-H295A cells, which possess features typical of fetal, rather than adult, adre- nal cells (e.g., expression of IGF-2 and P450aro) (23). The cells were propagated in hypoxic conditions for 15 d to acclimate them to this model intrauterine environment before “deliver- ing” them to normoxia. This transition induced changes in the abundance of many mRNAs, with many more changes after 2 d than after 1 d. Not surprisingly, one of the induced genes was HIF1A, which encodes a hypoxia-induced transcription factor (30). Most notably, after 2 d of normoxia, the abundances of the mRNAs for the steroidogenic factors 30HSD2, StAR, and P450c17 increased >1.6-fold. This will change the pattern of

Oxygen-induced perinatal adrenal changes

Articles

Table 1. Expression of 4 genes activated and 56 genes inhibited in NCI-H295A cells incubated under hypoxic conditions for 15 d, followed by normoxic conditions for 1 d
SymbolGeneMean ± SDªChromosomeFunction
MIR1974MicroRNA 19741.68 ±1.26MicroRNA
UCK2Uridine-cytidine kinase 21.51 ±0.161Pyrimidine metabolism
AP1S1Adaptor-related protein complex 1, sigma 1 subunit1.50±0.667Protein sorting in the late-Golgi/trans- Golgi network and/or endosomes
GINS4GINS complex subunit 4 (Sld5 homolog)1.50±0.678Initiation of DNA replication and progression of DNA replication forks
PEG3Paternally expressed 30.66±0.1019Apoptosis
LOC100132564Hypothetical protein LOC1001325640.66±0.2712Unknown
RNU1-3U1 small nuclear 30.66±0.221Component of the spliceosome
SNORA28Small nucleolar RNA, H/ACA box 280.66±0.0714Unknown
NARFNuclear prelamin A recognition factor0.66±0.0317Binds to the prenylated prelamin A carboxyl-terminal tail domain
VIL2Villin 20.66±0.106Actin cytoskeleton signaling
ANKRD37Ankyrin repeat domain 370.65±0.024Unknown
MT1HMetallothionein 1H0.65±0.1816Protein binding and zinc ion binding
LOC728188Similar to phosphoglycerate mutase processed protein0.65±0.11XUnknown
WDR54WD repeat domain 540.65±0.072Unknown
PGK1Phosphoglycerate kinase 10.64±0.06X ☒Glycolysis/gluconeogenesis
MTP18Mitochondrial protein 18 kDa0.64±0.0422Mitochondrial division
HIG-2Hypoxia-inducible lipid droplet-associated0.64±0.027Intracellular lipid accumulation
SNX26Sorting nexin 260.63±0.0319Intracellular trafficking
RNU1A3RNA, U1A3 small nuclear0.63±0.201Component of the spliceosome
SLC6A8Solute carrier family 6 (neurotransmitter transporter, creatine), member 80.63±0.10X ☒Creatine uptake in muscles and brain
PGM1Phosphoglucomutase 10.63±0.071Glycolysis/gluconeogenesis
PGAM1Phosphoglycerate mutase 1 (brain)0.63±0.0310Glycolysis/gluconeogenesis
C4orf3Chromosome 4 open reading frame 30.62±0.054Unknown
EZREzrin0.62±0.096Actin cytoskeleton signaling
PGAM1P8Phosphoglycerate mutase 1 pseudogene 80.62±0.0611Unknown
SLC2A3bSolute carrier family 2 (facilitated glucose transporter), member 30.62±0.0312Glucose transporter
ORM1Orosomucoid 10.62±0.039Transport protein in the blood stream
GPIGlucose phosphate isomerase0.61±0.0619Glycolysis/gluconeogenesis
LOC732165Similar to triosephosphate isomerase (TIM) (triose- phosphate isomerase)0.61 ±0.071Unknown
ADSSL1Adenylosuccinate synthase like 10.60±0.0714Component of the purine nucleotide cycle
MGC16121Hypothetical protein MGC161210.60±0.07X ☒Unknown
GAPDHbGlyceraldehyde-3-phosphate dehydrogenase0.60±0.0612Glycolysis/gluconeogenesis
EFHD2EF-hand domain family, member D20.59±0.041Calcium ion binding, protein binding
TPI1bTriosephosphate isomerase 10.59±0.0912Glycolysis/gluconeogenesis
PNCKPregnancy upregulated nonubiquitously expressed CaM kinase0.59±0.12X ☒Calcium signaling
TMEM45ATransmembrane protein 45A0.58±0.073Unknown
RN7SKRNA, 7SK small nuclear0.57 ±0.196Unknown
LOC732007Similar to phosphoglycerate mutase 1 (phosphoglycerate mutase isozyme B) (PGAM-B) (BPG-dependent PGAM 1)0.57 ±0.0812Unknown

Table 1. Continued on next page

Articles

Table 1. Continued
SymbolGeneMean ± SDªChromosomeFunction
PLOD1Procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 10.56±0.091Lysine degradation
JMJD1AbJumonji domain containing 1A0.55±0.062Histone demethylation
ALDOAbAldolase A, fructose-bisphosphate0.55±0.0616Glycolysis and gluconeogenesis
TPI1P2Triosephosphate isomerase 1 pseudogene 20.54±0.017Unknown
PFKPPhosphofructokinase, platelet0.53±0.0810Fructose and mannose metabolism; galactose metabolism; glycolysis/ gluconeogenesis
SLC6A10PSolute carrier family 6 (neurotransmitter transporter, creatine), member 100.52±0.1016Unknown
ENO1bEnolase 1, (alpha)0.51 ±0.041Glycolysis/gluconeogenesis
TPI1P1Triosephosphate isomerase 1 pseudogene 10.50±0.061Unknown
PKM2bPyruvate kinase, muscle0.49±0.0815Glycolysis/gluconeogenesis
BNIP3bBCL2/adenovirus E1B 19 kDa interacting protein 30.49±0.0810Nuclear gene encoding mitochondrial protein
SERPINA3Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 30.49±0.1114Plasma protease inhibitor
BNIP3LbBCL2/adenovirus E1B 19 kDa interacting protein 3-like0.47±0.018Apoptosis
LOC644774Similar to phosphoglycerate kinase 10.45±0.02XUnknown
SPRR2FSmall proline-rich protein 2F0.45±0.111Structural constituent of cytoskeleton
DDIT4DNA-damage-inducible transcript 40.45±0.0910Inhibits cell growth by regulating the mTOR signaling pathway
SLC2A1bSolute carrier family 2 (facilitated glucose transporter), member 10.44±0.031Glucose transporter
ALDOCbAldolase C, fructose-bisphosphate0.41±0.0717Glycolysis and gluconeogenesis
LDHAbLactate dehydrogenase A0.39±0.0411Glycolysis/gluconeogenesis
NDRG1bN-myc downstream regulated gene 10.36±0.088p53-mediated caspase activation and apoptosis
BHLHB2Basic helix-loop-helix domain containing, class B, 20.35±0.083Transcriptional factor modulating chondrogenesis in response to the cAMP pathway
CYP2J2Cytochrome P450, family 2, subfamily J, polypeptide 20.29±0.061Arachidonic acid metabolism; drug metabolism
PFKFB46-phosphofructo-2-kinase/fructose-2,6-biphosphatase 40.18±0.053Fructose and mannose metabolism

CAMP, cyclic adenosine monophosphate; mTOR, mammalian target of rapamycin. aThe data are expressed as mean fold change in normoxic conditions over control in hypoxic conditions ± SD. “Positive control genes known to be transcriptionally regulated by hypoxia.

steroidogenesis from 45 to 44 steroids, as is seen following birth.

Our study emphasizes analysis of mRNAs and did not mea- sure the abundances of steroidogenic enzyme proteins or the steroid products of our adrenal cell systems; such measure- ments will be of interest in future studies. In addition, our experimental design only examined events in the first 2 d fol- lowing the transition to normoxia, yet the involution of the fetal adrenal and the transition from fetal to newborn pattern of ste- roidogenesis takes several weeks, so that future studies may also examine a broader time frame. However, it seems likely that the rapid changes in oxygenation at delivery would constitute an acute trigger to change the adrenal’s transcriptional program- ming and that such acute changes would subsequently affect adrenal morphology and steroid secretory patterns over the first weeks of life, so we would expect that the changes in mRNA

abundances that we have measured would precede changes in adrenal morphology and steroid secretion. In this context, it may be important to add tropic activators of the protein kinase A pathway (adrenocorticotropic hormone to adrenal cells and 8-Br-cAMP to NCI-H295A cells), to mimic conditions in vivo.

Our data are consistent with our hypothesis that the change in oxygenation that follows birth is a key factor in determin- ing the change in the patterns of adrenal steroidogenesis that follow birth. However, no aspect of our data is inconsistent with the hypothesis that withdrawal of placental factors also plays a role, especially in the rapid involution of adrenal size, as known adrenal growth factors (IGF-2, EGF, FGF) (31) were not among the factors dramatically changed by the hypoxic- normoxic transition in our studies. Thus, we propose that both the hypoxic-normoxic transition and the potential with- drawal of placental factors are required to initiate the anatomic

Articles

Oxygen-induced perinatal adrenal changes

Table 2. Expression of 62 genes activated and 105 genes inhibited in NCI-H295A cells incubated under hypoxic conditions for 15 d, followed by normoxic conditions for 2 d
SymbolGeneMean ± SDªChromosomeFunction
PTMAProthymosin, alpha2.31 ± 1.782Mediate immune function
RPS2P28Ribosomal protein S2 pseudogene 282.18±0.646Unknown
RPS3P3Ribosomal protein S3 pseudogene 32.07 ±0.863Unknown
FLJ40504Hypothetical protein FLJ405041.98±0.4017Unknown
ID3Inhibitor of DNA binding 3, dominant negative helix- loop-helix protein1.91 ±0.311bHLH transcription factor binding
HSD3B2Hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 21.89±0.571Steroidogenesis
IGFBP2bInsulin-like growth factor binding protein 2, 36 kDa1.83±0.282IGF-1 signaling
StARSteroidogenic acute regulatory protein1.78±0.258Steroidogenesis
PL6P10Ribosomal protein L6 pseudogene 101.77 ±1.094Unknown
GSTA5Glutathione S-transferase alpha 51.77±0.136Conjugation of reduced glutathiones and electrophiles
LOC651816Similar to ubiquitin-conjugating enzyme E2S (ubiquitin-conjugating enzyme E2-24 kDa) (ubiquitin- protein ligase) (ubiquitin carrier protein) (E2-EPF5)1.76±0.52Unknown
HLA-GHLA-G histocompatibility antigen, class I, G1.75±0.766Allograft rejection signaling; antigen presentation pathway
LOC644936Cytoplasmic beta-actin pseudogene1.75±0.875Unknown
LOC647169Glutathione S-transferase alpha 3 pseudogene1.74±0.196Unknown
FLJ20489Hypothetical protein FLJ204891.72±0.4512Unknown
KRT18P31Keratin 18 pseudogene 311.70±0.125Unknown
RPS8P10Ribosomal protein S8 pseudogene 101.70±0.6110Unknown
FLJ43681Ribosomal protein L23a pseudogene1.68±0.2417Unknown
KLK1Kallikrein 11.65±0.2819Serine protease
CYP17A1Cytochrome P450, family 17, subfamily A, polypeptide 11.65±0.3210Steroidogenesis
RPL23AP64Ribosomal protein L23a pseudogene 641.64±0.2411Unknown
CD9CD9 molecule1.64±0.0912Platelet activation and aggregation, differentiation, adhesion, and signal transduction
PPPDE2PPPDE peptidase domain containing 21.63±0.4022Desumoylating isopeptidase
KRT18P59Keratin 18 pseudogene 591.62±0.2811Unknown
CCDC124Coiled-coil domain containing 1241.61 ±0.4819DNA binding
KRT8Keratin 81.60±0.1612Cellular structural integrity, signal transduction, and cellular differentiation
MICAMHC class I polypeptide-related sequence A1.60±0.186Antigen processing and presentation
PERPPERP, TP53 apoptosis effector1.60±0.466p53 signaling
LOC728602Ornithine decarboxylase antizyme 1 pseudogene1.60±0.481Unknown
GSTA2Glutathione S-transferase alpha 21.60±0.256Detoxification of electrophilic compounds
KRT18P13Keratin 18 pseudogene 131.60±0.179Unknown
RPS2P51Ribosomal protein S2 pseudogene 511.59±0.3219Unknown
RPL18AP3Ribosomal protein L18a pseudogene 31.59±0.2312Unknown
RPL28P5Ribosomal protein L28 pseudogene 51.58±0.1819Unknown
UCK2Uridine-cytidine kinase 21.58±0.351Pyrimidine metabolism
RPL7P32Ribosomal protein L7 pseudogene 321.58±0.027Unknown
KRT8P47Keratin 8 pseudogene 471.58±0.071Unknown
EBPEmopamil-binding protein (sterol isomerase)1.57 ±0.54XCholesterol biosynthesis

Table 2. Continued on next page

Articles

Agrawal et al.

Table 2. Continued
SymbolGeneMean ± SDªChromosomeFunction
CKBCreatine kinase, brain1.57±0.2914Transfer of phosphate between ATP and phosphogens
LOC730323Hypothetical LOC7303231.57±0.707Unknown
LOC389672Similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (colon carcinoma laminin-binding protein) (NEM/1CHD4) (multidrug resistance- associated protein MGr1-Ag)1.56±0.478Unknown
LOC649555Similar to eukaryotic translation initiation factor 4E1.56±0.1917Unknown
CATSPER2Cation channel, sperm associated 21.56±0.7715Voltage-gated calcium channel
NOP16NOP16 nucleolar protein homolog (yeast)1.55±0.165Unknown
LOC100134053Similar to POLR2J4 protein1.55±0.247Unknown
XBP1X-box binding protein 11.55±0.1822Endoplasmic reticulum stress pathway
LOC100128098Hypothetical protein LOC1001280981.54±0.6410Unknown
LOC642502Succinate dehydrogenase complex, subunit C, integral membrane protein, 15 kDa pseudogene1.54±0.3717Unknown
HMGN2P25High mobility group nucleosomal binding domain 2 pseudogene 251.53±0.253Unknown
PPIBPeptidylprolyl isomerase B (cyclophilin B)1.53±0.2015Folding of proteins
LOC100129502Hypothetical protein LOC1001295021.53±0.4215Unknown
SDF2L1Stromal cell-derived factor 2-like 11.53±0.2122Unknown
DCXRDicarbonyl/L-xylulose reductase1.52±0.1517Uronate cycle of glucose metabolism; osmoregulation in renal tubules
RPS26P35Ribosomal protein S26 pseudogene 351.52±0.248Unknown
LOC651149Similar to 60S ribosomal protein L3 (L4)1.52±0.0910Unknown
ADI1Acireductone dioxygenase 11.52±0.462Catalyzes the formation of formate and 2-keto-4-methylthiobutyrate from 1,2-dihydroxy-3-keto-5-methylthiopentene
RPSAP56Ribosomal protein SA pseudogene 561.51 ±0.2016Unknown
RPS2P29Ribosomal protein S2 pseudogene 291.51 ±0.276Unknown
CCT3Chaperonin containing TCP1, subunit 3 (gamma)1.51 ±0.231Molecular chaperone; assists the folding of proteins upon ATP hydrolysis
CDK5Cyclin-dependent kinase 51.51±0.317Cell cycle
RPL29P15Ribosomal protein L29 pseudogene 151.50±0.325Unknown
HIF1AHypoxia-inducible factor 1, alpha subunit1.50±0.4514Basic helix-loop-helix transcription factor activated in response to reduced oxygen availability in the cellular environment
SNORD13Small nucleolar RNA, C/D box 130.66±0.118Unknown
MTMR11Myotubularin-related protein 110.66±0.061Probable pseudophosphatase
MXD4MAX dimerization protein 40.66±0.044Transcriptional repressor
KANK4KN motif and ankyrin repeat domains 40.66±0.141Control of cytoskeleton formation by regulating actin polymerization
WDR54WD repeat domain 540.66±0.192Unknown
RNU1G2RNA, U1G2 small nuclear0.65±0.221Unknown
MYLK4Myosin light chain kinase family, member 40.65±0.076Protein serine/threonine kinase activity and ATP binding
HOXA5Homeobox A50.65±0.157Transcription factor
MT1HMetallothionein 1H0.65±0.0616Protein binding and zinc ion binding
RHBDL3Rhomboid, veinlet-like 3 (Drosophila)0.65±0.0517Intramembrane proteolysis
GOLGA8BGolgin A8 family, member B0.64±0.1115Maintaining Golgi structure
UBA7Ubiquitin-like modifier activating enzyme 70.64±0.043Activates ubiquitin

Table 2. Continued on next page

Oxygen-induced perinatal adrenal changes

Articles

Table 2. Continued
SymbolGeneMean ± SDªChromosomeFunction
C15orf52Chromosome 15 open reading frame 520.64±0.0515Unknown
PLOD2Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 20.64±0.023Lysine degradation
LOC286016Triosephosphate isomerase 1 pseudogene0.64±0.147Unknown
TAF1CTATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110 kDa0.64±0.0216Component of the transcription factor SL1/ TIF-IB complex
PHKA2Phosphorylase kinase, alpha 2 (liver)0.64±0.04XCatalyzes serine phosphorylation
IL11RAInterleukin 11 receptor, alpha0.64±0.039Receptor for interleukin-11
SLC6A8Solute carrier family 6 (neurotransmitter transporter, creatine), member 80.64±0.10XCreatine uptake in muscles and brain
TPI1P1Triosephosphate isomerase 1 pseudogene 10.64±0.101Unknown
ALDOAbAldolase A, fructose-bisphosphate0.64±0.0716Glycolysis and gluconeogenesis
GPIGlucose phosphate isomerase0.64±0.0319Glycolysis/gluconeogenesis; pentose phosphate pathway; starch and sucrose metabolism
SNORD3ASmall nucleolar RNA, C/D box 3A0.63±0.1117Unknown
KLHL3Kelch-like 3 (Drosophila)0.63±0.025Substrate-specific adapter of a BTB-CUL3- RBX1 E3 ubiquitin ligase complex
DDIT4LDNA-damage-inducible transcript 4-like0.63±0.074Inhibits cell growth by regulating the mTOR signaling pathway
DPYSL4Dihydropyrimidinase-like 40.63±0.0310Signaling by class 3 semaphorins and subsequent remodeling of the cytoskeleton
KLF2Kruppel-like factor 2 (lung)0.63±0.0419Binds CACCC box in the beta-globin gene promoter and activates transcription
RNU6-1RNA, U6 small nuclear 10.63±0.1715Unknown
COL11A1Collagen, type XI, alpha 10.63±0.081Fibrillogenesis
APBB3Amyloid beta (A4) precursor protein-binding, family B, member 30.63±0.045Internalization of beta-amyloid precursor protein
ZSWIM8ZSWIM8 zinc finger, SWIM-type containing 80.63±0.0410Unknown
PAMPeptidylglycine alpha-amidating monooxygenase0.63±0.025Catalyzes C-terminal alpha-amidation of peptides
MLLT6Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 60.62±0.0717Unknown
ANKRD37Ankyrin repeat domain 370.62±0.054Unknown
ZNF395Zinc finger protein 3950.62±0.048Unknown
SNORD113-5Small nucleolar RNA, C/D box 113-50.62±0.0514Unknown
ABP1Amiloride binding protein 1 (amine oxidase (copper- containing)0.62±0.147Degradation of putrescine, histamine, spermine, and spermidine
ZBTB40Zinc finger and BTB domain containing 400.62±0.071Unknown
TMEM123Transmembrane protein 1230.61 ±0.1711Oncotic cell death
RN5S9RNA, 5S ribosomal 90.61 ±0.271Unknown
RNU1F1RNA, U1F1 small nuclear0.61 ±0.2214Component of the spliceosome
WDR90WD repeat domain 900.61 ±0.0716Unknown
RNU6-15RNA, U6 small nuclear 150.61±0.15-Unknown
CLCNKAChloride channel Ka0.60±0.011Voltage-gated chloride channel
SNORD3CSmall nucleolar RNA, C/D box 3C0.60±0.1217Unknown
SIRPASignal-regulatory protein alpha0.60±0.0720Immunoglobulin-like cell surface receptor for CD47
TPI1bTriosephosphate isomerase 10.60±0.0412Unknown
SLC27A3Solute carrier family 27 (fatty acid transporter), member 30.60±0.091Acyl-CoA ligase activity

Articles

Agrawal et al.

Table 2. Continued
SymbolGeneMean ± SDªChromosomeFunction
CLCN7Chloride channel 70.60±0.0716Antiporter; contributes to the acidification of the lysosome lumen
TMEM45ATransmembrane protein 45A0.60±0.123Unknown
COL3A1Collagen, type III, alpha 10.60±0.092Regulation of cortical development
RNU1A3RNA, U1A3 small nuclear0.59±0.261Component of the spliceosome
JMJD1AbJumonji domain containing 1A0.59 ±0.082Histone demethylation
SNORD3DSmall nucleolar RNA, C/D box 3D (SNORD3D)0.59±0.1917Unknown
PPP1R3CProtein phosphatase 1, regulatory (inhibitor) subunit 3C0.59±0.1210Glycogen-targeting subunit for protein phosphatase 1
COL7A1Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive)0.59±0.033Stratified squamous epithelial basement membrane protein that forms anchoring fibrils
LOC100132564Hypothetical protein LOC1001325640.59±0.2312Unknown
PGK1Phosphoglycerate kinase 10.58±0.11XGlycolysis/gluconeogenesis
LOC100132394Hypothetical protein LOC1001323940.58±0.22XUnknown
CYP1A1Cytochrome P450, family 1, subfamily A, polypeptide 10.58±0.0415Xenobiotic metabolism
RAP1GAPRAP1 GTPase activating protein0.58±0.031GTPase activator
ALKBH5AlkB, alkylation repair homolog 5 (E. coli)0.57±0.0217Demethylation of RNA by oxidative demethylation
SVEP1Sushi, von Willebrand factor type A, EGF and pentraxin domain containing 10.57±0.069Cell attachment process
SCGB1D2Secretoglobin, family 1D, member 20.57±0.0711Bind androgens and other steroids
TMEM145Transmembrane protein 1450.56±0.1019Unknown
SLC2A3bSolute carrier family 2 (facilitated glucose transporter), member 30.56±0.0512Glucose transporter
FAM62BFamily with sequence similarity 62 (C2 domain containing) member B0.56±0.007Calcium-regulated intrinsic membrane protein
LOC644774Similar to phosphoglycerate kinase 10.56±0.04XUnknown
RNU1-3RNA, U1 small nuclear 30.56±0.241Component of the spliceosome
SLC6A10PSolute carrier family 6 (neurotransmitter transporter, creatine), member 10 (pseudogene)0.56±0.0916Unknown
RNU1-5RNA, U1 small nuclear 50.56±0.241Component of the spliceosome
bHK2Hexokinase 20.56±0.032Aminosugars metabolism; fructose and mannose metabolism; galactose metabolism; glycolysis/gluconeogenesis
MT1FMetallothionein 1F0.56±0.0816Cadmium ion binding and copper ion binding
STK36Serine/threonine kinase 36, fused homolog (Drosophila)0.56±0.022Sonic hedgehog signaling
COL22A1Collagen, type XXII, alpha 10.55±0.068Cell adhesion ligand for skin epithelial cells and fibroblasts
MST1Macrophage stimulating 1 (hepatocyte growth factor- like)0.55±0.033IL-12 signaling and production in macrophages; MSP-RON signaling pathway
PKM2bPyruvate kinase, muscle0.54±0.0515Glycolysis/gluconeogenesis
PFKPPhosphofructokinase, platelet0.54±0.0710Fructose and mannose metabolism; galactose metabolism; glycolysis/ gluconeogenesis
ARHGEF16Rho guanine exchange factor (GEF) 160.54±0.051Guanyl-nucleotide exchange factor activity
PNCKPregnancy upregulated nonubiquitously expressed CaM kinase0.54±0.08XCalcium signaling
ADSSL1Adenylosuccinate synthase like 10.54±0.0714Alanine and aspartate metabolism; purine metabolism
ENO1bEnolase 1, (alpha)0.53±0.041Glycolysis/gluconeogenesis

Table 2. Continued on next page

Table 2. Continued
SymbolGeneMean ± SDªChromosomeFunction
SSPOSCO-spondin homolog (Bos taurus)0.53±0.057Modulation of neuronal aggregation
PGM1Phosphoglucomutase 10.51 ±0.051Glycolysis/gluconeogenesis
SNX26Sorting nexin 260.51 ±0.0919Intracellular trafficking
MGC16121Hypothetical protein MGC161210.51 ±0.08XUnknown
VIL2Villin 2 (ezrin)0.51 ±0.076Actin cytoskeleton signaling
EFHD2EF-hand domain family, member D20.51±0.041Calcium ion binding, protein binding
RFTN1Raftlin, lipid raft linker 10.51 ±0.023Formation and/or maintenance of lipid rafts
EZREzrin0.50±0.116Actin cytoskeleton signaling
DDIT4DNA-damage-inducible transcript 40.49±0.0910Inhibits cell growth by regulating the mTOR signaling pathway
SLC2A1bSolute carrier family 2 (facilitated glucose transporter), member 10.47±0.031Glucose transporter
PLOD1Procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 10.47 ±0.051Lysine degradation
BNIP3bBCL2/adenovirus E1B 19 kDa interacting protein 30.47±0.0810Apoptosis
RN7SKRNA, 7SK small nuclear0.43±0.186Pre-mRNA splicing and processing
LDHAbLactate dehydrogenase A0.43±0.0211Glycolysis/gluconeogenesis
BNIP3LbBCL2/adenovirus E1B 19 kDa interacting protein 3-like0.41 ±0.028Apoptosis
RNU4-2RNA, U4 small nuclear 20.41 ±0.19Pre-mRNA splicing and processing
ALDOCbAldolase C, fructose-bisphosphate0.41±0.1217Glycolysis and gluconeogenesis
ORM1Orosomucoid 10.39±0.099Transport protein in the blood stream
SERPINA3Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 30.33±0.0814Plasma protease inhibitor
BHLHB2Basic helix-loop-helix domain containing, class B, 20.32±0.093Transcriptional factor modulating chondrogenesis in response to the cAMP pathway
NDRG1bN-myc downstream regulated gene 10.26±0.058p53-mediated caspase activation and apoptosis
CYP2J2Cytochrome P450, family 2, subfamily J, polypeptide 20.23±0.061Arachidonic acid metabolism; drug metabolism
PFKFB46-phosphofructo-2-kinase/fructose-2,6- biphosphatase 40.16±0.053Fructose and mannose metabolism

CAMP, cyclic adenosine monophosphate; mTOR, mammalian target of rapamycin.

aThe data are expressed as mean fold change in normoxic conditions over control in hypoxic conditions ± SD. bPositive control genes known to be transcriptionally regulated by hypoxia.

Table 3. Pathway analysis of genes downregulated in NCI-H295A cells incubated in hypoxic conditions for 15 d, followed by normoxic conditions for 1 d
Canonical pathwaysP valueMolecules
Glycolysis2.51 × 10-23PGK1, ENO1, GPI, TPI1, PGAM1, PKM2, GAPDH, ALDOA, PFKP, ALDOC
Sucrose degradation3.55×10-7TPI1, ALDOA, ALDOC
Vitamin C transport2.29×10-3SLC2A1, SLC2A3
TR/RXR activation3.80×10-3ENO1, SLC2A1, PFKP
HIF1 a signaling5.50×10-3SLC2A1, LDHA, SLC2A3

TR/RXR, thyroid hormone receptor/retinoid X receptor.

remodeling of the fetal adrenal and its change in steroidogenic patterns as the fetus transitions to extrauterine life. While there may be differences among expression levels of mRNAs, their encoded proteins, and downstream steroids, our preliminary

data suggest that the hypoxic/normoxic transition at birth is likely to be an important component of the perinatal changes in adrenal architecture and steroidogenesis.

METHODS

Cells

We used two cell systems. First, we used primary cultures from human fetal adrenals obtained with written consent from women undergoing elective procedures at San Francisco General Hospital. This research was performed with Institutional Review Board approval from the University of California San Francisco’s Committee on Human Research. All specimens were anonymous. The gestational age of the fetal specimens was estimated based on foot length. Second, we used the NCI-H295A human adrenocortical cell line (32) that expresses all adrenal steroidogenic enzymes (23) and has been selected to grow in monolayer (33). All cells were grown in Roswell Park Memorial Institute (RPMI) medium (UCSF cell culture facility) with 2% fetal bovine serum. All experiments were performed in triplicate. Hypoxic conditions consisted of an atmosphere of 2% oxygen, 93% nitro- gen, and 5% CO2 in the XVIVO hypoxia tissue culture hood from

a Total number of genes activated or inhibited in NCI-H295A cells in normoxia over control in hypoxia: 1 d normoxia, 60 genes (4 1 + 56 4)

2 d normoxia, 167 genes (62 1 + 105 4)

b

Figure 3. Summary of microarray gene expression profiles from NCI-H295A cells. NCI-H295A cells were incubated under hypoxic conditions for 15 d, fol- lowed by normoxic conditions for either 1 d or 2 d, while control cells were maintained under hypoxic conditions throughout the experiment. (a) Gene expression levels were calculated as the signal levels under normoxic condi- tions divided by the signal levels under hypoxic conditions for control cells. A fold change cutoff of >1.5-fold or <0.67-fold over control was chosen in our study. (b) Venn diagram showing gene expression profiles in NCI-H295A cells incubated under the above conditions. Arrows pointing upward and downward represent increased and decreased gene expression.

NCI 1 d

NCI 2 d

31

1 1

611 60 Į

11Į

45 ↓

Table 4. Pathway analysis of genes upregulated in NCI-H295A cells incubated in hypoxic conditions for 15 d, followed by normoxic conditions for 2 d
Canonical pathwaysP valueMolecules
Glutathione-mediated detoxification2.04×10-7GSTA2, GSTA5
Steroidogenesis8.51×10-7CYP17A1, EBP, HSD3B2, StAR
Crosstalk between dendritic cells and natural killer cells3.63×10-3HLA-G, MICA
p53 signaling4.37×10-2PERP, HIF1A
Table 5. Pathway analysis of genes downregulated in NCI-H295A cells incubated in hypoxic conditions for 15 d, followed by normoxic conditions for 2 d
Canonical pathwaysP valueMolecules
Glycolysis3.16×10-12PGK1, ENO1, GPI, TPI1, PKM2, ALDOA, PFKP, ALDOC
Sucrose degradation4.47×10-6TPI1, ALDOA, ALDOC
Systemic lupus erythematosus signaling6.17×10-4RNU1-3, RNU4-2, RNU6-1
Estrogen biosynthesis3.31 ×10-3CYP1A1, CYP2J2
Vitamin C transport7.76×10-3SLC2A1, SLC2A3
TR/RXR activation2.09×10-2ENO1, SLC2A1, PFKP
HIF1 a signaling2.95×10-2SLC2A1, LDHA, SLC2A3

TR/RXR, thyroid hormone receptor/retinoid X receptor.

BioSpherix (Lacona, NY). Constant oxygen levels were maintained in the hypoxia chamber throughout the experimental procedure and incubations. All plastic ware, pipette aids, tissue culture media, and buffers were equilibrated in the hypoxic conditions before use.

Incubations

Under an institutional review board-approved human experimenta- tion protocol, fetal adrenal tissues was transported in a full tube of

Table 6. Sequence of primers used for qRT-PCR
NameSequenceSize of product (bp)
CYP11A1 forward5'- TCC AGA AGT ATG GCC CGATT -3'75
CYP11A1 reverse5'- CAT CTT CAG GGT CGATGA CAT AAA -3'
CYP17A1 forward5'- TCT CTG GGC GGC CTC AA -3'63
CYP17A1 reverse5'- AGG CGATAC CCT TAC GGTTGT -3'
HSD3B2 forward5'- GGA AGA GAA GGA ACT GAA GGA G -3'194
HSD3B2 reverse5'- AGA CAT CAATGA TAC AGG CGG -3'
StAR forward5'- CCA CCC CTA GCA CGT GGAT -3'88
StAR reverse5'-TCCTGGTCA CTG TAG AGA GTCTCTTC-3'
GAPDH forward5'- CGG GGCTCT CCA GAA CAT CAT CC -3'199
GAPDH reverse5'- CGA CGC CTG CTT CAC CAC CTT CTT -3'
ACTIN forward5'- AACTCCATCATGAAGTGTGACG -3'234
ACTIN reverse5'- GATCCACATCTGCTGGAAGG -3'

qRT-PCR, quantitative reverse transcription PCR.

phosphate-buffered saline that had been degassed so as to minimize exposure to oxygen before arriving in the laboratory. All manipula- tions were done under hypoxic conditions. Fetal adrenals were de- encapsulated, the two adrenals were combined, minced into small pieces, rinsed twice with Ca/Mg-free Hank’s balanced salt solution, digested with 44 mg dispase (Life Technologies, Carlsbad, CA), 20 mg collagenase type I (Worthington Biochemical, Lakewood, NJ) at 37℃ for 40 min, filtered through 100 um nylon mesh, layered onto 5ml ficoll-paque plus (GE Healthcare, Piscataway, NJ), and centrifuged at 600g for 30 min at room temperature on an IEC centraGP8R cen- trifuge (Thermo Fisher Scientific, Waltham, MA). The cells from the resulting interphase was collected and washed, resuspended in RPMI medium, and incubated in the hypoxic environment. Cells from each fetus were incubated separately in duplicate cultures grown in hypoxic or normoxic conditions; subsequent RNA preparations and analyses were done separately.

NCI-H295A cells were incubated under hypoxic conditions for 15 d and were split twice before the start of the experiment. After 15 d, six 10-cm plates of cells were moved from hypoxic conditions to an incubator with room air (normoxia). RNA was isolated from three plates after 1 d in normoxia and from the other three plates after 2 d in normoxia. RNA was also isolated from three control plates main- tained in hypoxia.

RNA Analysis

Total RNA was isolated using TRIzol (Life Technologies) according to the manufacturer’s recommended protocol. For cells kept in hypoxia, homogenization with TRIzol was done under hypoxic conditions. RNA was quantitated using an ND-1000 NanoDrop spectrophotom- eter (Thermo Scientific).

For real-time quantitative reverse transcription-PCR, 1 µg total RNA was reverse transcribed using Superscript II reverse transcrip- tase (Life Technologies), and PCR was performed at 94 °℃ for 5 min, followed by 40 cycles of 94 ℃ for 0.5 min, 55 ℃ for 0.5 min, and 72 ℃ for 1 min using primers and probes for the cholesterol side- chain cleavage enzyme (P450scc, encoded by CYP11A1), P450c17, 3ßHSD2, StAR, glyceraldehyde-3-phosphate dehydrogenase, and actin (Table 6). Reactions were performed in a total volume 25 ul con- taining 2 ul complementary DNA and 12.5 ul FastStart SYBR Green Master (Roche, Mannheim, Germany) on an iCycler iQ Real Time Detection System (Bio-Rad, Hercules, CA).

For microarray experiments, 300 ng total RNA was used to pro- duce biotin-labeled complementary RNA using Illumina TotalPrep RNA amplification kit (Life Technologies) according to the manu- facturer’s recommended protocol. The biotinylated complementary

Oxygen-induced perinatal adrenal changes

Articles

RNA was eluted in nuclease-free water and was quantitated by NanoDrop spectrophotometer. Hybridization to the HumanHT-12 v4 BeadChip array (Illumina, San Diego, CA) was done at a com- plementary RNA concentration of 150 ng/ul in the UCSF Genomic Core Facility. The chips were scanned, and data were analyzed using Genome Studio Gene Expression Module (Illumina). Data were normalized using the “quantile” method of normalization in the software. Normalized data containing the signal levels and detection P values were exported into Microsoft Excel for gene expression analysis. The fold changes in gene expression levels were calculated as the gene signal levels under normoxic conditions divided by the signal levels under hypoxic conditions for control cells. The data are expressed as mean fold change in normoxia over control in hypoxia ± SD. Genes with signal detection of P > 0.05 in both normoxia and control groups were excluded from further analysis. An arbitrary fold change cutoff of >1.5-fold or <0.67-fold over control was chosen.

SUPPLEMENTARY MATERIAL

Supplementary material is linked to the online version of the paper at http:// www.nature.com/pr

ACKNOWLEDGMENTS

We thank Emin Maltepe for productive discussions and for the use of the hypoxia chamber, Marcus Schoneman for helpful advice, and the staff and faculty at San Francisco General Hospital Women’s Options Center for assistance in the collection of human fetal tissues. V.A. is currently Assistant Professor, Centre for Microbial Biotechnology, Panjab University, Chandigarh, India.

STATEMENT OF FINANCIAL SUPPORT

This work was supported by the University of California-San Francisco Molecular Endocrinology Fund; J.Q. was supported by the School of Medi- cine, Shanghai Jiao Tong University, Shanghai, China.

Disclosure: The authors have nothing to disclose. The authors report no con- flict of interest.

REFERENCES

1. Goto M, Piper Hanley K, Marcos J, et al. In humans, early cortisol biosyn- thesis provides a mechanism to safeguard female sexual development. J Clin Invest 2006;116:953-60.

2. Voutilainen R, Ilvesmäki V, Miettinen PJ. Low expression of 3 ß-hydroxy- 5-ene steroid dehydrogenase gene in human fetal adrenals in vivo; adreno- corticotropin and protein kinase C-dependent regulation in adrenocortical cultures. J Clin Endocrinol Metab 1991;72:761-7.

3. Kitada M, Kamataki T, Itahashi K, Rikihisa T, Kanakubo Y. P-450 HFLa, a form of cytochrome P-450 purified from human fetal livers, is the 16 a-hydroxylase of dehydroepiandrosterone 3-sulfate. J Biol Chem 1987;262:13534-7.

4. Miller KK, Cai J, Ripp SL, Pierce WM Jr, Rushmore TH, Prough RA. Stereo- and regioselectivity account for the diversity of dehydroepiandros- terone (DHEA) metabolites produced by liver microsomal cytochromes P450. Drug Metab Dispos 2004;32:305-13.

5. Leeder JS, Gaedigk R, Marcucci KA, et al. Variability of CYP3A7 expres- sion in human fetal liver. J Pharmacol Exp Ther 2005;314:626-35.

6. Kari MA, Raivio KO, Stenman UH, Voutilainen R. Serum cortisol, dehydroepi- androsterone sulfate, and steroid-binding globulins in preterm neonates: effect of gestational age and dexamethasone therapy. Pediatr Res 1996;40:319-24.

7. Miller WL. Steroid hormone biosynthesis and actions in the materno-feto- placental unit. Clin Perinatol 1998;25:799-817, v.

8. Siiteri PK, MacDonald PC. Placental estrogen biosynthesis during human pregnancy. J Clin Endocrinol Metab 1966;26:751-61.

9. Miller WL, Auchus RJ. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr Rev 2011;32:81-151.

10. McMahon SK, Pretorius CJ, Ungerer JP, et al. Neonatal complete general- ized glucocorticoid resistance and growth hormone deficiency caused by a novel homozygous mutation in helix 12 of the ligand binding domain

of the glucocorticoid receptor gene (NR3C1). J Clin Endocrinol Metab 2010;95:297-302.

11. Keene MF. Observations on the development of the human suprarenal gland. J Anat 1927;61(Pt 3):302-24.

12. Lanman JT. The fetal zone of the adrenal gland: its developmental course, comparative anatomy, and possible physiologic functions. Medicine (Balti- more) 1953;32:389-430.

13. Villee DB. The development of steroidogenesis. Am J Med 1972;53:533-44.

14. McNutt NS, Jones AL. Observations on the ultrastructure of cytodifferen- tiation in the human fetal adrenal cortex. Lab Invest 1970;22:513-27.

15. Spencer SJ, Mesiano S, Lee JY, Jaffe RB. Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. J Clin Endocrinol Metab 1999;84:1110-5.

16. Sucheston ME, Cannon MS. Development of zonular patterns in the human adrenal gland. J Morphol 1968;126:477-91.

17. Kojima S, Yanaihara T, Nakayama T. Serum steroid levels in children at birth and in early neonatal period. Am J Obstet Gynecol 1981;140:961-5.

18. Grueters A, Korth-Schutz S. Longitudinal study of plasma dehydroepi- androsterone sulfate in preterm and fullterm infants. J Clin Endocrinol Metab 1982;55:314-20.

19. Midgley PC, Russell K, Oates N, Holownia P, Shaw JC, Honour JW. Adre- nal function in preterm infants: ACTH may not be the sole regulator of the fetal zone. Pediatr Res 1998;44:887-93.

20. Ben-David S, Zuckerman-Levin N, Epelman M, et al. Parturition itself is the basis for fetal adrenal involution. J Clin Endocrinol Metab 2007;92:93-7.

21. Di Blasio AM, Voutilainen R, Jaffe RB, Miller WL. Hormonal regulation of messenger ribonucleic acids for P450scc (cholesterol side-chain cleavage enzyme) and P450c17 (17 a-hydroxylase/17,20-lyase) in cultured human fetal adrenal cells. J Clin Endocrinol Metab 1987;65:170-5.

22. Higashimura Y, Nakajima Y, Yamaji R, et al. Up-regulation of glyceral- dehyde-3-phosphate dehydrogenase gene expression by HIF-1 activity depending on Sp1 in hypoxic breast cancer cells. Arch Biochem Biophys 2011;509:1-8.

23. Staels B, Hum DW, Miller WL. Regulation of steroidogenesis in NCI- H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol 1993;7:423-33.

24. Halle C, Andersen E, Lando M, et al. Hypoxia-induced gene expression in chemoradioresistant cervical cancer revealed by dynamic contrast- enhanced MRI. Cancer Res 2012;72:5285-95.

25. Holland RC. The effect of hypoxia on the fetal rat adrenal. Anat Rec 1958;130:177-95.

26. Myers DA, Hyatt K, Mlynarczyk M, Bird IM, Ducsay CA. Long-term hypoxia represses the expression of key genes regulating cortisol bio- synthesis in the near-term ovine fetus. Am J Physiol Regul Integr Comp Physiol 2005;289:R1707-14.

27. Honour JH, Wickramaratne K, Valman HB. Adrenal function in preterm infants. Biol Neonate 1992;61:214-21.

28. Dunwoodie SL. The role of hypoxia in development of the mammalian embryo. Dev Cell 2009;17:755-73.

29. Rudolph AM. Fetal circulation and cardiovascular adjustments after birth. In: Rudolph AM, Hoffman JIE, Rudolph CD, eds. Rudolph’s Pediatrics, 20th edn. Stamford, CT: Appleton & Lange, 1996:1409-13.

30. Park AM, Sanders TA, Maltepe E. Hypoxia-inducible factor (HIF) and HIF-stabilizing agents in neonatal care. Semin Fetal Neonatal Med 2010;15:196-202.

31. Mesiano S, Mellon SH, Jaffe RB. Mitogenic action, regulation, and localiza- tion of insulin-like growth factors in the human fetal adrenal gland. J Clin Endocrinol Metab 1993;76:968-76.

32. Gazdar AF, Oie HK, Shackleton CH, et al. Establishment and characteriza- tion of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res 1990;50:5488-96.

33. Rodriguez H, Hum DW, Staels B, Miller WL. Transcription of the human genes for cytochrome P450scc and P450c17 is regulated differently in human adrenal NCI-H295 cells than in mouse adrenal Y1 cells. J Clin Endocrinol Metab 1997;82:365-71.